Entry information : ZmaPrx13 ( Zosma23g00750 [2.2])
Entry ID 11000
Creation 2012-05-15 (Qiang Li)
Last sequence changes 2016-04-11 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-04-11 (Achraf Jemmat)
Peroxidase information: ZmaPrx13 ( Zosma23g00750 [2.2])
Name (synonym) ZmaPrx13 ( Zosma23g00750 [2.2])
Class Class III peroxidase    [Orthogroup: Prx048]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Zosteraceae Zostera
Organism Zostera marina    [TaxId: 29655 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmaPrx13
start..stop
S start..stop
VvPrx31 382 1e-133 1..343 1..327
PpePrx14 380 1e-132 39..343 29..328
NnPrx21 379 3e-132 39..343 30..328
PtPrx28 371 3e-129 8..343 5..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 635255..635506 252 N° 2 635578..635766 189 N° 3 635865..636455 591  
join(635255..635506,635578..635766,635865..636455)


exon

Literature and cross-references ZmaPrx13 ( Zosma23g00750 [2.2])
DNA ref. Phytozome 12:   scaffold_23 (635255..636455)
Cluster/Prediction ref. Phytozome Gene 12:   33174063
Protein sequence: ZmaPrx13 ( Zosma23g00750 [2.2])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344 (314)
PWM (Da):   %s   37503.52 (34077.8)  
PI (pH):   %s   6.89 (6.67) Peptide Signal:   %s   cut: 30 range:30-343
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGYSTLFKAFSLCFLWFILYDAKISSAHAHAHAHDNSMLKYGFYSKTCPNAETIVRITLSNYVKQDVTVAAPVLRLHFHDCFVRGCDGSVLLNSTKNNKAEKDATINLTLDGFYVIDAAKAALEEACPGVVSCADIVALAARDAVYLSKGIYYEAQTGRRDGRVSHASEAAVKIPNSFSGFEELKANFAATGLDVKDLVVLSGAHTIGQSHCQNFAKRIYNYTGKGGDDDVDPTLNPNYIPILRKQCKPGDTTTTVDMVPGGSTTFDNDYYGLVNRNKGLFHSDAALLSNDETKAYVYTHRYSDQSNKSAFFQDFAVSMVKMGSYAVLTGEEGDIRKNCALLN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 3).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTATTCTACTTTGTTCAAAGCTTTCTCCTTATGCTTTCTCTGGTTTATCCTTTACGATGCCAAAATCAGCAGTGCTCATGCTCATGCTCATGCTCATGATAACTCAATGCTCAAA
TATGGGTTCTACAGCAAGACTTGTCCTAACGCCGAAACCATAGTTCGCATCACACTTTCCAACTACGTCAAGCAAGATGTCACCGTTGCCGCCCCAGTGCTCAGACTCCATTTCCATGAT
TGTTTTGTCCGG
GTATATATAGATATATAGATAACTTATTTATAGAGTTATAATTATTTAAGCTCATTTGATATCATTTATAGGGATGTGATGGATCTGTTCTCTTGAATTCCACAAAGA
ATAACAAGGCAGAGAAGGACGCGACGATAAATCTGACACTAGACGGATTCTACGTCATCGATGCAGCGAAAGCTGCTTTGGAAGAGGCATGTCCGGGAGTGGTTTCATGCGCTGATATCG
TCGCTCTCGCCGCAAGGGACGCCGTGTATTTG
GTAAAATAAGTGTGTGTATATATATATATATATATCGATGTTGATTATAACTTGGCTAGTGGCTGGTTGCTGAACATACGTATATTTG
GTGTGTTTAGAGTAAAGGAATTTATTATGAAGCTCAGACTGGTAGGAGAGACGGACGAGTATCGCATGCATCAGAAGCGGCTGTAAAGATACCTAATTCCTTTTCCGGATTCGAAGAGTT
GAAAGCCAACTTCGCCGCAACAGGACTAGACGTCAAGGATCTGGTTGTTCTTTCCGGTGCACACACCATCGGTCAGTCTCACTGTCAGAATTTCGCAAAGCGGATCTACAATTACACTGG
GAAAGGAGGGGATGACGACGTGGATCCGACGTTGAATCCAAACTACATACCAATCTTAAGGAAACAGTGCAAACCTGGAGACACAACAACGACTGTCGACATGGTTCCAGGCGGTTCCAC
CACATTTGACAATGATTACTACGGTTTGGTGAATAGAAACAAGGGTCTATTCCACTCTGATGCTGCTCTTCTAAGTAACGACGAAACTAAAGCTTACGTATACACCCACCGATACTCCGA
CCAATCTAACAAGTCCGCTTTCTTCCAAGATTTTGCTGTTTCCATGGTCAAAATGGGAAGCTACGCTGTTCTTACGGGAGAGGAAGGCGATATCAGGAAAAATTGCGCTCTCCTAAATTA
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTATTCTACTTTGTTCAAAGCTTTCTCCTTATGCTTTCTCTGGTTTATCCTTTACGATGCCAAAATCAGCAGTGCTCATGCTCATGCTCATGCTCATGATAACTCAATGCTCAAA
TATGGGTTCTACAGCAAGACTTGTCCTAACGCCGAAACCATAGTTCGCATCACACTTTCCAACTACGTCAAGCAAGATGTCACCGTTGCCGCCCCAGTGCTCAGACTCCATTTCCATGAT
TGTTTTGTCCGG
GGATGTGATGGATCTGTTCTCTTGAATTCCACAAAGAATAACAAGGCAGAGAAGGACGCGACGATAAATCTGACACTAGACGGATTCTACGTCATCGATGCAGCGAAA
GCTGCTTTGGAAGAGGCATGTCCGGGAGTGGTTTCATGCGCTGATATCGTCGCTCTCGCCGCAAGGGACGCCGTGTATTTG
AGTAAAGGAATTTATTATGAAGCTCAGACTGGTAGGAGA
GACGGACGAGTATCGCATGCATCAGAAGCGGCTGTAAAGATACCTAATTCCTTTTCCGGATTCGAAGAGTTGAAAGCCAACTTCGCCGCAACAGGACTAGACGTCAAGGATCTGGTTGTT
CTTTCCGGTGCACACACCATCGGTCAGTCTCACTGTCAGAATTTCGCAAAGCGGATCTACAATTACACTGGGAAAGGAGGGGATGACGACGTGGATCCGACGTTGAATCCAAACTACATA
CCAATCTTAAGGAAACAGTGCAAACCTGGAGACACAACAACGACTGTCGACATGGTTCCAGGCGGTTCCACCACATTTGACAATGATTACTACGGTTTGGTGAATAGAAACAAGGGTCTA
TTCCACTCTGATGCTGCTCTTCTAAGTAACGACGAAACTAAAGCTTACGTATACACCCACCGATACTCCGACCAATCTAACAAGTCCGCTTTCTTCCAAGATTTTGCTGTTTCCATGGTC
AAAATGGGAAGCTACGCTGTTCTTACGGGAGAGGAAGGCGATATCAGGAAAAATTGCGCTCTCCTAAATTAA

Retrieve as FASTA