Entry information : OsPrx91(LOC_Os06g48020)
Entry ID 1101
Creation 2006-08-22 (Filippo Passardi)
Last sequence changes 2006-08-22 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx91(LOC_Os06g48020)
Name OsPrx91(LOC_Os06g48020)
Class Class III peroxidase    [Orthogroup: Prx113]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx91
start..stop
S start..stop
SbPrx141 504 0 19..319 21..320
ZmPrx133 495 1e-178 4..319 7..320
BdiPrx21 486 3e-175 27..319 24..314
SiPrx36 486 5e-175 1..319 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28652216..28652434 219 N° 2 28652564..28652761 198 N° 3 28653663..28653822 160 N° 4 28654057..28654439 383
join(28652216..28652434,28652564..28652761,28653663..28653822,28654057..28654439 )


exon

Literature and cross-references OsPrx91(LOC_Os06g48020)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1K2
DNA ref. GenBank:   NC_008399.1 (28652216..28654436)
Protein sequence: OsPrx91(LOC_Os06g48020)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (303)
PWM (Da):   %s   33959.65 (32484.9)  
PI (pH):   %s   7.31 (7.31) Peptide Signal:   %s   cut: 17 range:17-319
Sequence 360
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASLAGLAFLAVTSAALLSPLAVVGQLRTDYYSTICPNLETIVRSSVKQSMAASPISAPATLRLFFHDCAVRGCDASIMIVNSNGDDEWRNSDNQSLKPEGFTTVLNAKAAVDSDPQCRYKVSCADILALAARESVYQSGGPNYQVELGRYDGRVSTRDSVVLPHANFNLDQLNAFFAGLGLSQTDMIALSGGHTFGAADCRFFQYRIGADPAMDQGFAAQLRNTCGGNPNNFAFLNGATPAAFDNAYYRGLQQGRGLLGSDQALHADQRSRGTVDYYAWSQSAFFGGFAAAMTRLGRVGVKTAATGGEIRRDCRFPN

Retrieve as FASTA  
Remarks chromosome 6. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGGCGAGCCTTGCTGGGTTGGCATTCCTCGCCGTCACGTCGGCCGCGCTGCTGTCGCCGCTCGCCGTGGTTGGCCAGCTGAGGACGGACTACTACTCCACCATCTGCCCCAACCTGG
AGACCATCGTCCGGAGCTCCGTCAAGCAGTCCATGGCCGCGTCACCGATCTCCGCGCCGGCGACGCTCAGGCTCTTCTTCCACGACTGCGCCGTCAGG
GTACATCTAGAGATTGCAACAG
ATAATGATCGATCGACCGCCATAGATCGATGCAAGCAATGTGGTGATCAGAATATCAGATCAGTAGAAGTAAGCAGTGATCACTGCAGTGTGTGATTTCGATTGCAGGGTTGTGACGCGT
CGATCATGATCGTGAACTCGAACGGCGACGACGAGTGGCGGAACTCAGACAACCAGTCGCTGAAGCCGGAGGGGTTCACGACGGTGCTCAACGCCAAGGCCGCCGTCGACAGCGATCCAC
AGTGCCGCTACAAGGTGTCCTGCGCCGACATATTGGCGCTCGCCGCAAGAGAATCCGTCTACCAG
GTTAGCATAGCAAGAAATTTTACAGCACTTCGAGATACCAAAATTTTCAGTTTAA
ATTTAAGTGATTTTATAGTTTTTAAGGAGATACCATGTTTTCTATTTTCTACTGTTTTTTTAGATGAAGGCATTACGCCCAGCTTTCACTAAAAAGCATAAGAGTTCATACATTGAAAAA
AGAGGAAAAGCAGTAAAAACTAGGGAAACTGTTTTAAGCACTCGGGTGGATGTCCACCCGTTTCTTGCATGTCATCTAAATAGTTATGGAAATTTTTTTATAAAATTAACATGATAGGTT
AATATGTAATATATCATTTCACAATACTAAGATATACGGAAATTTGCACTAAAATTTTGTTATCTTTTAGTACTTTTAAGAACTGTAGAATATATTTGCAAATTTTCATATATCTTATAA
TATTGAAGATATTGGGAGATACTCCCTCCATACTCATAAAGGAAGTCGTTTAGGACAGCAACACGGTCTCCAAAACATAATTTTGACTTTTTATTTCTATAAAAATATTTATTGAAAAGT
GATATATGTATACTTTTATGAAAGTATTTTTCAAGACAAATCTATACGTATAATTTTTACATTTTGAAACTCAACAACTTAAGAGTTATTCATGATTTATATTTTTAGGGTTTGACTTAA
ATATTGTCCTAAACGACTTTCTTTATGAGTATGGAGGGAACGACTTTCTTTATGAGTATTAAGGGAGTACCAAATTTTACATTAAAAAATATTATACCTCCGGACGGTAAACTCACTTTA
GCATAGCAGATTAAATTTGCACACATGGGCATGCATGCATGATGGGTAAAAAAATTGATCGTGAGATCGCGCGTTCAACGCTGTAACTAATCCTGCATGGATGCATGCATTGGCTGGTTG
GTGCAGAGCGGAGGGCCCAACTACCAGGTGGAGCTGGGGAGATACGACGGCAGGGTGTCAACCAGAGACAGCGTAGTGCTGCCGCATGCCAACTTCAACCTGGACCAGCTCAACGCTTTC
TTCGCCGGCCTCGGCCTCTCCCAGACTGACATGATCGCTCTCTCAG
GTACTCCAAAAATGTCTAATCAACTCAACTCATCGTCGTCATCGTGGACTAAAAACTTCACCCGATAGCTGTAC
ATCCATTGACGATCCGATCGATCGATCGATCGATCTTGTCACTTGCCCAACAATTCATCAATCTGCACACCTTTTCCACACACGTACGTCGCTTGCGATTACTCCAATCTGTGTGACTGA
TCGGTCGCGAATTCGCATCGTCACTTGCGCGTGAATTCAGGTGGGCACACGTTCGGCGCGGCGGACTGCAGGTTCTTCCAGTACAGGATCGGCGCCGACCCAGCCATGGACCAGGGCTTC
GCGGCGCAGCTGCGCAACACCTGCGGCGGCAACCCCAACAACTTCGCGTTCCTCAACGGCGCGACGCCGGCGGCGTTCGACAACGCGTACTACCGGGGCCTGCAGCAAGGCAGGGGGCTC
CTCGGCTCCGACCAGGCGCTGCACGCCGACCAGCGGTCGCGCGGCACCGTCGACTACTACGCGTGGAGCCAGAGCGCCTTCTTCGGCGGCTTCGCCGCCGCCATGACCAGGCTCGGGAGG
GTCGGCGTCAAGACGGCGGCCACCGGCGGCGAGATACGCCGCGACTGCAGATTCCCGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGGCGAGCCTTGCTGGGTTGGCATTCCTCGCCGTCACGTCGGCCGCGCTGCTGTCGCCGCTCGCCGTGGTTGGCCAGCTGAGGACGGACTACTACTCCACCATCTGCCCCAACCTGG
AGACCATCGTCCGGAGCTCCGTCAAGCAGTCCATGGCCGCGTCACCGATCTCCGCGCCGGCGACGCTCAGGCTCTTCTTCCACGACTGCGCCGTCAGG
GGTTGTGACGCGTCGATCATGA
TCGTGAACTCGAACGGCGACGACGAGTGGCGGAACTCAGACAACCAGTCGCTGAAGCCGGAGGGGTTCACGACGGTGCTCAACGCCAAGGCCGCCGTCGACAGCGATCCACAGTGCCGCT
ACAAGGTGTCCTGCGCCGACATATTGGCGCTCGCCGCAAGAGAATCCGTCTACCAG
AGCGGAGGGCCCAACTACCAGGTGGAGCTGGGGAGATACGACGGCAGGGTGTCAACCAGAGACA
GCGTAGTGCTGCCGCATGCCAACTTCAACCTGGACCAGCTCAACGCTTTCTTCGCCGGCCTCGGCCTCTCCCAGACTGACATGATCGCTCTCTCAG
GTGGGCACACGTTCGGCGCGGCGG
ACTGCAGGTTCTTCCAGTACAGGATCGGCGCCGACCCAGCCATGGACCAGGGCTTCGCGGCGCAGCTGCGCAACACCTGCGGCGGCAACCCCAACAACTTCGCGTTCCTCAACGGCGCGA
CGCCGGCGGCGTTCGACAACGCGTACTACCGGGGCCTGCAGCAAGGCAGGGGGCTCCTCGGCTCCGACCAGGCGCTGCACGCCGACCAGCGGTCGCGCGGCACCGTCGACTACTACGCGT
GGAGCCAGAGCGCCTTCTTCGGCGGCTTCGCCGCCGCCATGACCAGGCTCGGGAGGGTCGGCGTCAAGACGGCGGCCACCGGCGGCGAGATACGCCGCGACTGCAGATTCCCGAATTGA

Retrieve as FASTA