Entry information : CheKat02_C5
Entry ID 11067
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2012-05-22 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-05-22 (Christophe Dunand)
Peroxidase information: CheKat02_C5
Name CheKat02_C5
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Pleosporaceae Cochliobolus
Organism Cochliobolus heterostrophus    [TaxId: 5016 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CheKat02_C5
start..stop
S start..stop
CheKat02_C4 1551 0 1..740 1..740
PtritKat01 1453 0 1..740 1..740
PnoKat02 1344 0 1..740 1..743
CfulKat02 1122 0 3..740 7..745
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 460120..460350 231 N° 2 460405..462396 1992  
join(460120..460350,460405..462396)


exon

Literature and cross-references CheKat02_C5
DNA ref. JGI genome:   scaffold_15 (460120..462396)
Protein sequence: CheKat02_C5
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   740
PWM (Da):   %s   83017.01  
PI (pH):   %s   6.1
Sequence 781
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASEILGNVTEKAKDLAGSKSTKMAQLAEVTKDVHDDKWRITSDYGVKQNNTDDWLKVATDDQTGPMLLEDQFAREKIHRFDHERIPERVVHARGSGAFGKFTLFESASDVTSAGILTDTSRETPVFLRFSTVLGSRGSADTVRDVRGFAVKFYTEEGNWDIVGNNIPVFFIQDSMKFPDVIHAGKPEPDCEVPQAQSAHNNFWDFQYMHPEATHMFMWAMSDRTIPRSYRMMQGFGVNTYTLINAKGERHFVKFHFTPELGVHSFVWDEALKIAGQDPDFHRKDLWMAIDSGAYPKWKFGIQVIPEAKEHDFEFDILDATKVWPEELVPVRYIGELELNKNPDEFFTQTEQVAFCTSHIVPGIGFSNDPLLQGRNFSYQDTQLSRLGINWEELPINKPVCPVMNFNRDGAMRHTITKGKVNYWPNRFQTVPPATEKEGGYVEFPEKTAGIKVRMQSKKFREHKSQAELFYNSMSENEKMHMKAAFAFELDHCDDPVVYERLCERLCEIDLELAQSVAEMVGGEQPTKQTRPKHNKTAKGLSQMDFQPEKPTIATRMVAILIADGYDKAAYTGMKAALTAAGALPFTISPRRNKIFADGEDRSGSGVVADHHLEGQRSTMYDSVFVPGGARSIETLSKNGRAVHWVREAFGHLKAIGGTGEAVSFIKQAVDLPGMEFSTSGDVVNSYGVVTATAVQPESFKEAVNMVKEAKDFASAYMYAISQHKNFERETAGLNAMVAY

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCATCTGAAATACTAGGCAACGTTACGGAGAAGGCCAAGGACCTTGCTGGGTCCAAGTCGACCAAGATGGCTCAGCTTGCTGAAGTCACCAAAGATGTCCACGACGACAAGTGGAGGA
TTACCAGCGACTATGGAGTGAAGCAGAACAACACCGACGACTGGCTAAAGGTTGCCACGGACGACCAGACTGGCCCTATGTTGCTCGAGGACCAATTTGCGCGTGAAAAG
GTATGCTTGG
CCATGAACCAGCCGACGTATTCGCCACATGGCTAACAGCATTAGATCCACCGATTCGACCATGAAAGAATTCCCGAGCGTGTTGTTCACGCGCGTGGCTCGGGTGCTTTTGGAAAATTTA
CTCTTTTCGAGTCGGCCTCGGATGTCACATCGGCTGGCATCCTCACGGATACTTCGCGCGAAACTCCAGTCTTCCTACGATTCTCGACTGTGCTTGGTAGCCGTGGTTCTGCAGACACTG
TCCGCGATGTGCGCGGCTTTGCTGTCAAGTTCTACACGGAAGAAGGCAACTGGGATATTGTGGGTAACAACATTCCCGTCTTTTTCATCCAAGACTCGATGAAGTTTCCCGATGTGATCC
ATGCTGGCAAGCCGGAGCCGGACTGCGAGGTCCCACAAGCACAATCTGCTCACAACAACTTCTGGGACTTCCAGTACATGCACCCCGAAGCCACGCACATGTTCATGTGGGCCATGTCTG
ACCGCACGATTCCTCGCTCGTACCGAATGATGCAGGGTTTCGGTGTCAACACATACACTCTTATCAATGCCAAGGGCGAGAGGCATTTTGTCAAGTTCCACTTCACACCTGAACTTGGTG
TTCACAGCTTCGTCTGGGATGAGGCGCTGAAGATTGCTGGTCAAGACCCAGACTTCCACCGCAAGGACTTGTGGATGGCCATCGACAGCGGTGCGTACCCCAAGTGGAAGTTTGGCATTC
AAGTCATTCCCGAGGCAAAGGAGCATGACTTCGAATTCGACATTCTCGATGCTACCAAAGTATGGCCTGAGGAACTTGTGCCCGTCCGATACATTGGCGAGCTTGAGCTCAACAAGAACC
CTGACGAGTTCTTTACACAGACTGAGCAAGTCGCCTTCTGCACAAGCCACATTGTTCCCGGCATAGGCTTCAGCAACGACCCCCTTCTACAGGGCCGCAACTTCTCTTATCAAGACACTC
AACTCTCTCGTCTGGGCATCAACTGGGAAGAGCTACCAATCAACAAGCCCGTCTGCCCCGTCATGAACTTCAACCGTGATGGTGCCATGCGACACACAATCACAAAGGGCAAGGTCAACT
ACTGGCCCAACCGCTTCCAGACTGTGCCACCTGCGACAGAGAAGGAGGGTGGATACGTGGAGTTCCCTGAGAAGACTGCCGGCATCAAGGTGCGCATGCAAAGCAAAAAGTTCAGGGAGC
ACAAGAGCCAGGCCGAGCTCTTCTACAACTCCATGTCGGAGAACGAAAAGATGCACATGAAGGCTGCTTTTGCCTTTGAGCTTGACCACTGCGACGATCCGGTTGTGTACGAGCGCCTCT
GTGAGCGTCTGTGCGAGATTGATCTCGAGCTCGCTCAGAGTGTTGCCGAGATGGTTGGCGGCGAGCAACCGACCAAGCAGACCCGGCCCAAGCACAACAAGACAGCCAAGGGCCTGTCGC
AAATGGACTTTCAGCCCGAGAAGCCTACGATTGCGACTCGCATGGTGGCAATTCTTATTGCCGACGGCTACGACAAGGCTGCCTACACTGGCATGAAGGCTGCTTTGACTGCGGCTGGGG
CTCTGCCTTTTACCATTTCGCCGAGAAGGAACAAGATCTTTGCGGATGGAGAGGACAGGAGCGGCTCTGGAGTAGTGGCAGACCACCATCTTGAGGGCCAACGATCGACCATGTATGACA
GTGTCTTCGTTCCTGGTGGGGCCAGGTCGATTGAGACGCTCAGCAAGAACGGACGTGCGGTACACTGGGTGCGTGAGGCATTTGGCCACCTCAAGGCCATTGGTGGTACCGGCGAAGCAG
TTTCCTTCATCAAGCAGGCTGTGGATCTACCCGGCATGGAATTCTCAACGTCGGGCGATGTGGTCAACAGCTACGGAGTCGTTACGGCTACGGCAGTGCAGCCCGAGAGCTTCAAGGAGG
CGGTCAACATGGTGAAGGAGGCCAAGGACTTTGCGAGCGCGTACATGTATGCGATTTCGCAGCACAAGAACTTTGAGCGCGAGACTGCGGGGCTGAACGCCATGGTTGCATACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCATCTGAAATACTAGGCAACGTTACGGAGAAGGCCAAGGACCTTGCTGGGTCCAAGTCGACCAAGATGGCTCAGCTTGCTGAAGTCACCAAAGATGTCCACGACGACAAGTGGAGGA
TTACCAGCGACTATGGAGTGAAGCAGAACAACACCGACGACTGGCTAAAGGTTGCCACGGACGACCAGACTGGCCCTATGTTGCTCGAGGACCAATTTGCGCGTGAAAAG
ATCCACCGAT
TCGACCATGAAAGAATTCCCGAGCGTGTTGTTCACGCGCGTGGCTCGGGTGCTTTTGGAAAATTTACTCTTTTCGAGTCGGCCTCGGATGTCACATCGGCTGGCATCCTCACGGATACTT
CGCGCGAAACTCCAGTCTTCCTACGATTCTCGACTGTGCTTGGTAGCCGTGGTTCTGCAGACACTGTCCGCGATGTGCGCGGCTTTGCTGTCAAGTTCTACACGGAAGAAGGCAACTGGG
ATATTGTGGGTAACAACATTCCCGTCTTTTTCATCCAAGACTCGATGAAGTTTCCCGATGTGATCCATGCTGGCAAGCCGGAGCCGGACTGCGAGGTCCCACAAGCACAATCTGCTCACA
ACAACTTCTGGGACTTCCAGTACATGCACCCCGAAGCCACGCACATGTTCATGTGGGCCATGTCTGACCGCACGATTCCTCGCTCGTACCGAATGATGCAGGGTTTCGGTGTCAACACAT
ACACTCTTATCAATGCCAAGGGCGAGAGGCATTTTGTCAAGTTCCACTTCACACCTGAACTTGGTGTTCACAGCTTCGTCTGGGATGAGGCGCTGAAGATTGCTGGTCAAGACCCAGACT
TCCACCGCAAGGACTTGTGGATGGCCATCGACAGCGGTGCGTACCCCAAGTGGAAGTTTGGCATTCAAGTCATTCCCGAGGCAAAGGAGCATGACTTCGAATTCGACATTCTCGATGCTA
CCAAAGTATGGCCTGAGGAACTTGTGCCCGTCCGATACATTGGCGAGCTTGAGCTCAACAAGAACCCTGACGAGTTCTTTACACAGACTGAGCAAGTCGCCTTCTGCACAAGCCACATTG
TTCCCGGCATAGGCTTCAGCAACGACCCCCTTCTACAGGGCCGCAACTTCTCTTATCAAGACACTCAACTCTCTCGTCTGGGCATCAACTGGGAAGAGCTACCAATCAACAAGCCCGTCT
GCCCCGTCATGAACTTCAACCGTGATGGTGCCATGCGACACACAATCACAAAGGGCAAGGTCAACTACTGGCCCAACCGCTTCCAGACTGTGCCACCTGCGACAGAGAAGGAGGGTGGAT
ACGTGGAGTTCCCTGAGAAGACTGCCGGCATCAAGGTGCGCATGCAAAGCAAAAAGTTCAGGGAGCACAAGAGCCAGGCCGAGCTCTTCTACAACTCCATGTCGGAGAACGAAAAGATGC
ACATGAAGGCTGCTTTTGCCTTTGAGCTTGACCACTGCGACGATCCGGTTGTGTACGAGCGCCTCTGTGAGCGTCTGTGCGAGATTGATCTCGAGCTCGCTCAGAGTGTTGCCGAGATGG
TTGGCGGCGAGCAACCGACCAAGCAGACCCGGCCCAAGCACAACAAGACAGCCAAGGGCCTGTCGCAAATGGACTTTCAGCCCGAGAAGCCTACGATTGCGACTCGCATGGTGGCAATTC
TTATTGCCGACGGCTACGACAAGGCTGCCTACACTGGCATGAAGGCTGCTTTGACTGCGGCTGGGGCTCTGCCTTTTACCATTTCGCCGAGAAGGAACAAGATCTTTGCGGATGGAGAGG
ACAGGAGCGGCTCTGGAGTAGTGGCAGACCACCATCTTGAGGGCCAACGATCGACCATGTATGACAGTGTCTTCGTTCCTGGTGGGGCCAGGTCGATTGAGACGCTCAGCAAGAACGGAC
GTGCGGTACACTGGGTGCGTGAGGCATTTGGCCACCTCAAGGCCATTGGTGGTACCGGCGAAGCAGTTTCCTTCATCAAGCAGGCTGTGGATCTACCCGGCATGGAATTCTCAACGTCGG
GCGATGTGGTCAACAGCTACGGAGTCGTTACGGCTACGGCAGTGCAGCCCGAGAGCTTCAAGGAGGCGGTCAACATGGTGAAGGAGGCCAAGGACTTTGCGAGCGCGTACATGTATGCGA
TTTCGCAGCACAAGAACTTTGAGCGCGAGACTGCGGGGCTGAACGCCATGGTTGCATACTAA

Retrieve as FASTA