Entry information : OsPrx99(LOC_Os07g06175)
Entry ID 1109
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2006-07-26 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2022-02-11 (Christophe Dunand)
Peroxidase information: OsPrx99(LOC_Os07g06175)
Name OsPrx99(LOC_Os07g06175)
Class Class III peroxidase    [Orthogroup: Prx280]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx99
start..stop
S start..stop
OsPrx08 621 0 1..345 1..340
OsPrx[P]99-2 607 0 54..348 1..295
OsPrx[P]99-1 607 0 54..348 1..295
BdiPrx61 489 2e-175 1..346 1..345
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3043594..3043818 225 N° 2 3045494..3046315 822  
join(3043594..3043818,3045494..3046315)


exon

Literature and cross-references OsPrx99(LOC_Os07g06175)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q69QL4
DNA ref. GenBank:   NC_008400.1 (3043594..3046312)
Protein sequence: OsPrx99(LOC_Os07g06175)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (323)
PWM (Da):   %s   37412.95 (35027.7)  
PI (pH):   %s   5.43 (5.42) Peptide Signal:   %s   cut: 26 range:26-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLTVAIVCAMATALLAAAPSSAEAGDGELKVGYYDNKCSGVEDIVRSHVIKAIIQDRGIGGSLIRLIFHDCFVRGCDGSVLLNASDENPRPETAAPVSIGLEGFDILEEIKADLERRCPGVVSCADILIFAARDASSILSNGRVRFDVPAGRLDGVVSSAYEAQAELPDPTFTIRQLIDNFARKNFTVEELVVLSGAHSVGDGHCSSFTARLAAPPDQITPSYRNLLNYRCSRGGGADPAVVNNARDEDLATVARFMPAFVGKLRPVSALDNTYYRNNLDKVVNFNSDWQLLTQDEARGHVREYADNAALWDHDFAASLLKLSKLPMPVGSKGEIRNKCGAINHSKS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 7, intron 1). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTCACGGTAGCAATTGTCTGTGCCATGGCGACCGCGCTTCTCGCCGCCGCCCCGTCGTCGGCGGAGGCCGGCGACGGCGAGCTGAAGGTGGGCTACTACGACAACAAATGCAGC
GGCGTCGAGGACATCGTCAGGTCGCACGTCATCAAGGCTATCATACAGGACCGCGGCATAGGCGGCTCCCTCATCCGTCTCATCTTCCATGATTGTTTTGTCAGG
GTATATTTTGTTTCT
TCCTCCGTTTAATAATGTAAGTCATTCTATCATTTCTCACATTCATATTAATGTTAATGAATCTAGATATATACATTTCCTATCTAGATTCATTAACATCAATATGAATATGGGAAATGA
TAGAATGACTTACATTGTGTAACGGAGTGAGTACATATCGGTACTTCATCTATTTCATATTATAAATTGTTTCGGGTTTTAAATGGATTTATGAGTGAATTCATTTATATTACCTCTATT
TCTCATTATAAGTCATTCTATTTTTTTTCCTAGTCAAACTTTCAATTTATAGAAAAATATAGTAACTTTTTCAGCACAAAGAAAATATTATATTATCAAAATGTATTAAATGTTAATCTT
AATGATATTAATTTGGTGTTGTAAATGTTGCTAAAATTTTTCATAAACTTAATCAAACTTAAAAAGGTTTGAAAAAAAATTAAAATGAGTTATAATACTCTCTCCATCATATTCCAAATC
TAAAAAATTTACTTTTGATAGGCATATTTCAATCCAACCACCTATTTTTTTAATGACTTTCTTGGATTTCATGGGGGTGGCTAATTGGCGCGCGCCCGCCTGTTGGCCCCGGCCCGGAAG
CCCATCAGGCTTCTTTTTTTCTTTTTTTTCGCAAGATTTTTTTGCGATTTTTTTGCCTTTTTCTTTTATCTTTTTTTCGCTTTTGTCTTATTACTTTTTTAATCTTTAGCACACATATTT
TTTCAAAAAATGTTTTGAGTTGAAAATTTTTAAATCTTTAACTTGAAAATTTTAAATTTTGATTTGAAAGTTATCAAATCTTAAGTTGAAAGTTTTCGAATATGAGTTGAAAGTTTTTAA
TCTCAAGTTGAAAACTTTTAAATCTGAGTTGAAAGTTTTCAAATCAGAGTTGAAAGTTTTCAAGTCGAAGTTGAAAGTTTTCAAATCTGGGTTGAAAATTTTTCAAATTTAAGATGAAAA
GTTGAAAGTTCCAAAATTTGACTTTAAAAAATTTAAATTTTGAGTTAAAAGTTTTTAAATCTGGGTTGAAAATTTTCAAATCTAGATTGAAAGTTTCAAATTTTGAGTGGAAAGTTTTTA
AATTTGAGATGAAAGTTTTCAAATATGGATTGAAAACGTTTCAAATTTGAATTGAAAGTATTCAAATATCAGTTAAAAGTTTAAAATTTTGAGTTCAAAGTAATAACACAAAAATAGAAA
ATAACTAAAAAAACAAAACGTGAAAAAAAAGGGAAAAAGATGTGGGCCTAACAGAAAAAACACAAACGACGAGTCCTTTCTCAATAAAAAAAGTGCGCGCTATTTGCTTAACTCGCGCAG
CTTTTCCGGAATTTAATGCGTGACTCTCCATTCTTCCACGCAATATTGGCTATATAGGCATCGAGAAATGTAAATATATTAATAAATCGCTTGTTTACGAGAAATAACTAGTAGCATATT
TAAATGGATGATAAGTAAAATTACTTATCTTTGATCGGTGTATTAAGATAAAATATAACTATAAAAAGTAATGAAGGGAGTACGAAACAGAGGACCAAAACAACTTATATAGTGAAAAGG
AGTAGTAGTTTTGAAGCACTAAGGAGGTACTAGTAGCTTTGAAGCACTTGGGACTAATGAGTGGTTGCACAATGCATGCATGCATGCATGAGTATTGCAGGGTTGCGATGGTTCCGTCCT
CCTTAACGCGTCCGACGAGAACCCTCGTCCTGAGACGGCAGCGCCGGTGAGCATCGGGCTGGAAGGATTCGACATCCTGGAGGAGATCAAGGCCGATCTCGAGAGGAGGTGCCCCGGCGT
GGTCTCCTGCGCCGACATCCTCATCTTCGCCGCCCGCGACGCCAGCAGCATCCTCAGCAACGGCCGCGTCCGCTTCGACGTCCCCGCGGGCCGCCTCGACGGCGTCGTCTCCTCCGCCTA
CGAGGCCCAGGCGGAGCTCCCGGATCCCACCTTCACCATCCGGCAGCTCATCGACAACTTCGCCCGCAAGAACTTCACCGTCGAGGAGCTCGTCGTCCTCTCCGGCGCGCACTCCGTCGG
CGACGGCCACTGCTCCTCCTTCACCGCCCGCCTCGCCGCGCCGCCCGACCAGATCACCCCGTCCTACCGCAACCTGCTCAACTACAGGTGCTCCCGCGGCGGCGGCGCCGACCCTGCGGT
GGTGAACAACGCCCGCGACGAGGACCTCGCCACCGTGGCGAGGTTCATGCCGGCGTTCGTCGGCAAGCTGCGGCCGGTCAGCGCCCTGGACAACACCTACTACCGCAACAACCTCGACAA
GGTGGTCAACTTCAACTCGGACTGGCAGCTGCTGACGCAGGACGAGGCGCGCGGCCACGTCCGCGAGTACGCCGACAACGCCGCCCTCTGGGACCACGACTTCGCCGCCTCGCTGCTCAA
GCTCAGCAAGCTGCCCATGCCGGTGGGGAGCAAGGGGGAGATCAGGAACAAGTGCGGCGCCATCAACCACAGCAAGAGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTCACGGTAGCAATTGTCTGTGCCATGGCGACCGCGCTTCTCGCCGCCGCCCCGTCGTCGGCGGAGGCCGGCGACGGCGAGCTGAAGGTGGGCTACTACGACAACAAATGCAGC
GGCGTCGAGGACATCGTCAGGTCGCACGTCATCAAGGCTATCATACAGGACCGCGGCATAGGCGGCTCCCTCATCCGTCTCATCTTCCATGATTGTTTTGTCAGG
GGTTGCGATGGTTCC
GTCCTCCTTAACGCGTCCGACGAGAACCCTCGTCCTGAGACGGCAGCGCCGGTGAGCATCGGGCTGGAAGGATTCGACATCCTGGAGGAGATCAAGGCCGATCTCGAGAGGAGGTGCCCC
GGCGTGGTCTCCTGCGCCGACATCCTCATCTTCGCCGCCCGCGACGCCAGCAGCATCCTCAGCAACGGCCGCGTCCGCTTCGACGTCCCCGCGGGCCGCCTCGACGGCGTCGTCTCCTCC
GCCTACGAGGCCCAGGCGGAGCTCCCGGATCCCACCTTCACCATCCGGCAGCTCATCGACAACTTCGCCCGCAAGAACTTCACCGTCGAGGAGCTCGTCGTCCTCTCCGGCGCGCACTCC
GTCGGCGACGGCCACTGCTCCTCCTTCACCGCCCGCCTCGCCGCGCCGCCCGACCAGATCACCCCGTCCTACCGCAACCTGCTCAACTACAGGTGCTCCCGCGGCGGCGGCGCCGACCCT
GCGGTGGTGAACAACGCCCGCGACGAGGACCTCGCCACCGTGGCGAGGTTCATGCCGGCGTTCGTCGGCAAGCTGCGGCCGGTCAGCGCCCTGGACAACACCTACTACCGCAACAACCTC
GACAAGGTGGTCAACTTCAACTCGGACTGGCAGCTGCTGACGCAGGACGAGGCGCGCGGCCACGTCCGCGAGTACGCCGACAACGCCGCCCTCTGGGACCACGACTTCGCCGCCTCGCTG
CTCAAGCTCAGCAAGCTGCCCATGCCGGTGGGGAGCAAGGGGGAGATCAGGAACAAGTGCGGCGCCATCAACCACAGCAAGAGCTAA

Retrieve as FASTA