Entry information : CsubAPx01
Entry ID 11186
Creation 2012-07-04 (Christophe Dunand)
Last sequence changes 2012-07-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-07-04 (Christophe Dunand)
Peroxidase information: CsubAPx01
Name CsubAPx01
Class Ascorbate peroxidase     [Orthogroup: APx003]*
Taxonomy Eukaryota Viridiplantae Chlorophyta Trebouxiophyceae Coccomyxaceae Coccomyxa
Organism Coccomyxa subellipsoidea    [TaxId: 248742 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsubAPx01
start..stop
S start..stop
McalAPx04 242 1e-79 5..299 3..292
MpalAPx02 241 2e-79 5..299 3..292
CatmAPx01_UTEX2591 242 2e-79 6..300 4..301
MeAPx09 241 3e-79 5..300 3..282
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 364406..364587 182 N° 2 364772..364872 101 N° 3 365027..365095 69 N° 4 365228..365280 53
N° 5 365633..365805 173 N° 6 366139..366244 106 N° 7 366675..366905 231  
join(364406..364587,364772..364872,365027..365095,365228..365280,365633..365805, 366139..366244,366675..366905)


exon

Literature and cross-references CsubAPx01
DNA ref. GenBank:   AGSI01000017.1 (364406..366905)
Protein sequence: CsubAPx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   304
PWM (Da):   %s   32754.17 Transmb domain:   %s   o271-293i
PI (pH):   %s   9.13
Sequence 345
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAGAPKVDAAYKDAVNKASLDVRDLINKENCIPMLIRLAFNDALTYDAPTNTSGANGSIRIKKELTHEGNKGLQHAVDLLKPIKEKYPNLTYADFFQLAGMLAVEAAGGPVIPFTPGRKDSWSFPPPGRLPDPTDATSHLRAVAERLGLPLRQFVALMGAHKLGRWWRDVQPPYFHQFYAPGPLKFDNVYFKDLVSGKLPKDGYLLGDVEFRQIIETYAEDEAIFTADYVVAHEALSLLGTKLPPAREVAAAAAAAAASADGQSLQLPAGAQAAIGVAAVVIGAVVIGGWYWRRRRRLQGSAA

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAGCAGGGGCGCCCAAGGTGGATGCAGCCTACAAGGATGCCGTTAACAAGGCTTCTCTCGACGTGAGAGACCTTATAAATAAAGAGAATTGCATTCCCATGCTGATCAGGCTGGCCT
TCAACGACGCACTTACTTATGACGCTCCAACTAACACATCGGGAGCAAACGGCAGCATCAG
GTCCAGATTCGGCTATAAAATCTGAGTAATATGCATCAACAATTATATTCAACTCAAAA
TGATGTGCTTGAGGGCAATTTGCAGTGTAAGTACATTTTGATGCTTGCAACCTCGGAAGAAGCGCAGGAGCATACGCATGAGCCCCCTGTCCTGGAACAAGCTAGACCCTGTGATATTGT
TACAGAATCAAGAAGGAGCTGACGCATGAAGGAAACAAGGGGCTGCAGCATGCAGTGGACCTGCTGAAGCCCATCAAGGAGAAATACCCCAACCTCACCTATGCAGGTATTTCTCGTTCA
CAATCTGTCAATATGTTTGCAAAATTTCATTTGCTGACTTGGAAACCGAGGAATCAACTGGACTTGGAAAGTGAGAGCTCAAGTCCTGGGCTAGCCTATGAAGTGTTTGCTTCTATCAGA
CAATTCCGATGCTGCTGCAGATTTCTTTCAGCTGGCGGGTATGCTGGCCGTGGAGGCTGCTGGAGGCCCAGTGATCCCCTTCACTCCAGGTTAGTCTGTGTTGCCAGCCAGATTGTTGCC
CCTATGATCGCATGAACGGAATGCTCCCAGGGGGTGCTGAGAAAGACCCAATGACTCTGCTCATGAAGTATATTGCTTGATGTTTTGCCCTGGACTGACAGGGCGCAAGGACTCCTGGTC
ATTCCCGCCTCCCGGCAGATTGCCCGACCCCACA
GTTGGTGAGTCACCCCAAGCATGCCCAGACTGCTCCTCTGCAACCACACTTTTTTTCCCACACCTCCAGAAACAGGTTTCTACACA
ATACACTGCTAACATGGCCTGCTGTGCCGGGCCTAGCACATCCCTGTGCACTTGCCACACCCAAACCTTCGCCTATCGTTCCATCTTGGACCAGTGTGCATGCAGCAGCTAGCTTACACT
TGCTTGTGATTGCCTCCCCTGACCGTTCTGGCATTCCCCTACCTTTGTGCAGAGCTCCGCAAGCCCCGGATCCATCCTGCTTATCATGTCAAACATTTCGCTGTGGCTCTGGATTGAGCG
CCTGTTCTGGCATGCGCGCAGCAGAGGACGCCACGTCGCACCTGCGCGCGGTGGCGGAGCGGCTGGGGCTGCCCCTGCGTCAGTTTGTGGCGCTGATGGGCGCTCACAAGCTCGGCCGCT
GGTGGCGCGACGTGCAGCCGCCCTACTTCCACCAGTTCTACGCCCCCGGGCCCCTCAAGTTTGACAATGTCTACTTCAA
GTGCGCTGCCCCAAAGTATACACATCCATTTTCTGGAGCTG
TGGATGCAATGCAGTTACTAGTGCAATGTAAGCTTGTCTGCAGATCCAAAGTGGGATCTTGCAGTATATGCAAAGCTGCCTCCCTGTCGCAGCACAGACACGACACCCATGCACGAGGTA
ATTCAGGCGGAGTGGTGATAACACCTAATGTTGAGGTGGCACAAGATAGCGGTTCTGCAAGTGTGCCTTCACAGCCCTTGCAGTGGCGACAAGCAAGGAGGGCTGTGAGTAGGCACACCT
GCTTTTTCATGATGCTTACATGTTGTGAACTGGTGCGGCTTGCTGCGCGCAGGGATTTGGTGAGCGGGAAGCTGCCCAAGGACGGCTACCTGCTGGGCGATGTGGAGTTCCGCCAGATCA
TTGAGACCTATGCAGAGGACGAGGCCATCTTCACCGCG
GTGCGATCTTTGCCCGCCTCTTTCTCATAGATAGGCAATCTGCAAAATAGGTGTTTCGGCAGTATATAGACACAGCAGTTCT
CGTGAGTTCATTGCAAGGTTCCTGCTCGGTGCAAGATTCCTGCTCAGCTGATCTCTTGTGGCAACACAGCAGTTTTCATGAGCTCAGTGCAAGGCTCCTGCTCGGCTGATCGCTTGTGGG
AACACAGTGGTTTTTGTGCGGCGAGTGCATGATCTCCTGCCTTGAGGAGCTGGTCCTGTGGCTCTCCAGAACCACATGTCGCATTCAACATGAGCGAGTGGGGCTCAATTCTGTTGTAGT
CTTCTGAGTAGATCATGTTGCAAAATAGGGGCTGAGGGCAATGGGAGCGCAGTATTTAGGTTGAGGCACATCTTGCACAGTGCACCTTAGAGACTTAATGGATTGCAGGACTATGTTGTG
GCGCACGAGGCGCTGTCGCTACTCGGCACGAAGCTGCCGCCCGCGCGCGAGGTGGCCGCTGCGGCGGCGGCGGCGGCCGCTTCGGCAGACGGGCAGTCGCTGCAGCTGCCGGCGGGCGCG
CAGGCGGCCATCGGCGTGGCGGCCGTAGTCATCGGGGCGGTAGTTATTGGCGGCTGGTACTGGCGGCGGCGCCGGCGGCTGCAGGGGTCGGCCGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAGCAGGGGCGCCCAAGGTGGATGCAGCCTACAAGGATGCCGTTAACAAGGCTTCTCTCGACGTGAGAGACCTTATAAATAAAGAGAATTGCATTCCCATGCTGATCAGGCTGGCCT
TCAACGACGCACTTACTTATGACGCTCCAACTAACACATCGGGAGCAAACGGCAGCATCAG
AATCAAGAAGGAGCTGACGCATGAAGGAAACAAGGGGCTGCAGCATGCAGTGGACCTGC
TGAAGCCCATCAAGGAGAAATACCCCAACCTCACCTATGCAG
ATTTCTTTCAGCTGGCGGGTATGCTGGCCGTGGAGGCTGCTGGAGGCCCAGTGATCCCCTTCACTCCAGGGCGCAAGG
ACTCCTGGTCATTCCCGCCTCCCGGCAGATTGCCCGACCCCACA
GACGCCACGTCGCACCTGCGCGCGGTGGCGGAGCGGCTGGGGCTGCCCCTGCGTCAGTTTGTGGCGCTGATGGGCG
CTCACAAGCTCGGCCGCTGGTGGCGCGACGTGCAGCCGCCCTACTTCCACCAGTTCTACGCCCCCGGGCCCCTCAAGTTTGACAATGTCTACTTCAA
GGATTTGGTGAGCGGGAAGCTGC
CCAAGGACGGCTACCTGCTGGGCGATGTGGAGTTCCGCCAGATCATTGAGACCTATGCAGAGGACGAGGCCATCTTCACCGCG
GACTATGTTGTGGCGCACGAGGCGCTGTCGCTACTCG
GCACGAAGCTGCCGCCCGCGCGCGAGGTGGCCGCTGCGGCGGCGGCGGCGGCCGCTTCGGCAGACGGGCAGTCGCTGCAGCTGCCGGCGGGCGCGCAGGCGGCCATCGGCGTGGCGGCCG
TAGTCATCGGGGCGGTAGTTATTGGCGGCTGGTACTGGCGGCGGCGCCGGCGGCTGCAGGGGTCGGCCGCCTGA

Retrieve as FASTA