Entry information : SAcoCcP01
Entry ID 11211
Creation 2012-07-19 (Christophe Dunand)
Last sequence changes 2012-07-19 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: SAcoCcP01
Name SAcoCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP002]
Taxonomy Eukaryota Fungi Ascomycota Saitoella
Organism Saitoella complicata    [TaxId: 5606 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SAcoCcP01
start..stop
S start..stop
TdefCcP01 397 1e-140 2..286 8..298
AresCcP01 379 3e-133 1..269 1..273
YlCcP01 369 6e-130 4..286 3..285
MvarCcP02 369 3e-129 1..268 1..272
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21486..22292 807 N° 2 22350..22403 54  
join(21486..22292,22350..22403)


exon

Literature and cross-references SAcoCcP01
DNA ref. JGI genome:   scaffold_3 (21486..22403)
Cluster/Prediction ref. JGI gene:   33259
Protein sequence: SAcoCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   287
PWM (Da):   %s   32068.95  
PI (pH):   %s   5.44
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTKEHDYDAVRAEIKKILPQPGYDAGSSGPVLVRLAWHCSGTYDKTTNTGGSNGATMRYAIEANDPANAGLEHAREFLEPVKSKFPWISYGDLWTLAGVVALEEMGGPRVEWRGGRLDHTDDSNVPPNGRLPDASQGCPHLRDVFYRMNFSDQEIVALSGAHTLGQCHPDRSGFDGPWVRNPIRFSNTYFKLLLAETWTPKINVAGNLQFRDDDDEIMMLPTDMALLDDPKFVKWVKIYAEDKERFFKDFAGVFGKLIELGVQREEGGNRKTEVRDLDKEGPKAKL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCAAAGAACACGACTACGACGCGGTCAGAGCCGAAATCAAGAAGATCCTCCCCCAGCCCGGCTACGACGCCGGTTCGTCCGGCCCAGTCCTCGTCCGCCTCGCCTGGCACTGCTCA
GGGACTTACGACAAAACAACCAACACAGGCGGCTCAAACGGCGCAACAATGCGCTACGCCATCGAAGCCAACGACCCCGCAAACGCCGGTCTCGAACACGCGCGTGAATTCCTCGAACCC
GTCAAGTCCAAGTTTCCATGGATTTCGTATGGAGACCTTTGGACGCTCGCCGGTGTTGTCGCGTTGGAGGAGATGGGTGGGCCGAGGGTTGAGTGGAGGGGTGGGAGGTTGGATCACACG
GATGACTCGAACGTCCCGCCTAATGGCCGTCTCCCCGATGCCTCACAGGGGTGCCCCCACCTCCGCGACGTCTTCTACCGCATGAACTTTTCCGACCAAGAAATCGTCGCTTTATCCGGC
GCGCACACACTCGGCCAATGCCACCCCGACCGCTCCGGTTTCGATGGGCCCTGGGTTCGCAATCCGATTCGTTTTTCGAATACATACTTCAAACTCCTCCTCGCGGAAACTTGGACCCCG
AAAATCAATGTAGCAGGAAACCTCCAGTTCCGTGACGACGACGACGAGATCATGATGCTCCCCACCGACATGGCACTCCTCGATGATCCTAAATTCGTGAAATGGGTCAAGATCTACGCG
GAGGATAAGGAGAGGTTCTTCAAGGATTTTGCGGGAGTGTTTGGGAAGTTGATCGAGTTGGGGGTACAGAGGGAGGAGGGCGGGAAT
GTGGTTAAGAGGGGCATGGATAGCGGGGATAAG
AGTGTTTGGGTTGAGGGAGCGGAGAGGAAGACGGAGGTTAGGGATTTGGACAAGGAGGGGCCGAAGGCGAAGTTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCAAAGAACACGACTACGACGCGGTCAGAGCCGAAATCAAGAAGATCCTCCCCCAGCCCGGCTACGACGCCGGTTCGTCCGGCCCAGTCCTCGTCCGCCTCGCCTGGCACTGCTCA
GGGACTTACGACAAAACAACCAACACAGGCGGCTCAAACGGCGCAACAATGCGCTACGCCATCGAAGCCAACGACCCCGCAAACGCCGGTCTCGAACACGCGCGTGAATTCCTCGAACCC
GTCAAGTCCAAGTTTCCATGGATTTCGTATGGAGACCTTTGGACGCTCGCCGGTGTTGTCGCGTTGGAGGAGATGGGTGGGCCGAGGGTTGAGTGGAGGGGTGGGAGGTTGGATCACACG
GATGACTCGAACGTCCCGCCTAATGGCCGTCTCCCCGATGCCTCACAGGGGTGCCCCCACCTCCGCGACGTCTTCTACCGCATGAACTTTTCCGACCAAGAAATCGTCGCTTTATCCGGC
GCGCACACACTCGGCCAATGCCACCCCGACCGCTCCGGTTTCGATGGGCCCTGGGTTCGCAATCCGATTCGTTTTTCGAATACATACTTCAAACTCCTCCTCGCGGAAACTTGGACCCCG
AAAATCAATGTAGCAGGAAACCTCCAGTTCCGTGACGACGACGACGAGATCATGATGCTCCCCACCGACATGGCACTCCTCGATGATCCTAAATTCGTGAAATGGGTCAAGATCTACGCG
GAGGATAAGGAGAGGTTCTTCAAGGATTTTGCGGGAGTGTTTGGGAAGTTGATCGAGTTGGGGGTACAGAGGGAGGAGGGCGGGAAT
AGGAAGACGGAGGTTAGGGATTTGGACAAGGAG
GGGCCGAAGGCGAAGTTGTAG

Retrieve as FASTA