Entry information : SAcoHalPrx02
Entry ID 11214
Creation 2012-07-19 (Christophe Dunand)
Last sequence changes 2012-07-19 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: SAcoHalPrx02
Name SAcoHalPrx02
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Ascomycota Saitoella
Organism Saitoella complicata    [TaxId: 5606 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SAcoHalPrx02
start..stop
S start..stop
SAcoHalPrx01 241 2e-79 22..250 1..237
CcinHalPrx02 115 3e-30 67..253 53..244
CcinHalPrx01 114 1e-29 67..253 52..243
LbiHalPrx01 113 2e-29 64..248 53..242
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 456081..456343 263 N° 2 455277..456027 751  
complement(join(455277..456027,456081..456343))


exon

Literature and cross-references SAcoHalPrx02
DNA ref. JGI genome:   scaffold_6 (456343..455277)
Cluster/Prediction ref. JGI gene:   228849
Protein sequence: SAcoHalPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337
PWM (Da):   %s   37598.49 Transmb domain:   %s   i21-43o
PI (pH):   %s   8.43
Sequence 379
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSDTVRAQFFPLRLLLIPYQIISGLVNLVTVVSNMIYLFPTLLYAQYTFKPKPLEQLRLGAEYYRAPGEFDHRTPCPGLNALANHGVIPHDGKKVSPVELYHALRDYYSANFPSCWALLSGALQSSWDGRTIDLGALCRHNLIEHDASLTRPDSGFGDQRKADPALLKKFISCSKDGKYLTIDDIGRYRVERVRHSKEINPTYSLDLPHRILSYGEPTLLLDVFGDGKKVSTHIVESFMAEERFPNGYVPKLLRTNKPGESLSLLGSWSKAFAVSVAMAKAEKEMAGEEFKTTAITKATEKVLAAADNVPRKVGNRTQQLYEKLDPVCDGLSGEKDL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCGACACAGTCAGAGCCCAGTTCTTTCCCCTACGCCTCCTACTCATTCCCTATCAAATCATCAGCGGTCTTGTCAACCTCGTCACTGTCGTTTCCAACATGATATACCTTTTTCCC
ACGCTTCTCTATGCGCAGTATACCTTCAAGCCTAAGCCGCTTGAACAACTTCGCCTTGGTGCAGAATACTACAGAGCTCCTGGTGAGTTTGACCATAGGACCCCTTGTCCTGGGTTGAAC
GCATTGGCGAATCATGGTGTGAT
GTACGTCTACACCAGCATGTTCTTCTTTAACCACAGACACTAATGATTTGCAGTCCTCATGACGGCAAGAAAGTCAGCCCAGTCGAACTCTACCATG
CACTTCGTGATTACTACTCCGCCAATTTTCCCAGCTGCTGGGCTTTGTTGTCCGGCGCCCTCCAAAGCTCTTGGGATGGCCGCACCATTGATCTCGGCGCGTTATGTCGCCACAACCTGA
TTGAGCACGATGCCTCTCTGACCAGGCCTGACTCCGGTTTTGGAGATCAGAGGAAGGCTGATCCCGCCTTGCTGAAGAAATTCATCAGCTGCAGTAAGGATGGGAAGTATTTGACGATCG
ACGACATTGGAAGGTACAGGGTGGAACGTGTGAGGCATTCGAAGGAGATCAACCCAACTTACTCCCTCGACCTACCTCACCGAATTCTCTCGTACGGCGAACCCACCCTTCTCCTCGACG
TATTCGGTGATGGCAAGAAAGTTTCTACACATATTGTGGAAAGTTTCATGGCAGAGGAAAGGTTCCCAAATGGCTACGTCCCGAAGTTGTTGCGCACGAATAAACCAGGAGAGAGTTTGA
GTCTTCTCGGAAGCTGGAGCAAAGCGTTTGCTGTATCTGTGGCAATGGCGAAGGCTGAGAAGGAGATGGCGGGAGAGGAGTTCAAGACTACGGCGATCACTAAAGCTACAGAGAAGGTGT
TGGCTGCTGCAGATAATGTCCCTCGCAAGGTGGGGAACAGGACTCAACAACTTTACGAGAAGCTTGATCCTGTTTGTGATGGTTTGTCTGGCGAGAAAGATTTGTG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCGACACAGTCAGAGCCCAGTTCTTTCCCCTACGCCTCCTACTCATTCCCTATCAAATCATCAGCGGTCTTGTCAACCTCGTCACTGTCGTTTCCAACATGATATACCTTTTTCCC
ACGCTTCTCTATGCGCAGTATACCTTCAAGCCTAAGCCGCTTGAACAACTTCGCCTTGGTGCAGAATACTACAGAGCTCCTGGTGAGTTTGACCATAGGACCCCTTGTCCTGGGTTGAAC
GCATTGGCGAATCATGGTGTGAT
TCCTCATGACGGCAAGAAAGTCAGCCCAGTCGAACTCTACCATGCACTTCGTGATTACTACTCCGCCAATTTTCCCAGCTGCTGGGCTTTGTTGTCC
GGCGCCCTCCAAAGCTCTTGGGATGGCCGCACCATTGATCTCGGCGCGTTATGTCGCCACAACCTGATTGAGCACGATGCCTCTCTGACCAGGCCTGACTCCGGTTTTGGAGATCAGAGG
AAGGCTGATCCCGCCTTGCTGAAGAAATTCATCAGCTGCAGTAAGGATGGGAAGTATTTGACGATCGACGACATTGGAAGGTACAGGGTGGAACGTGTGAGGCATTCGAAGGAGATCAAC
CCAACTTACTCCCTCGACCTACCTCACCGAATTCTCTCGTACGGCGAACCCACCCTTCTCCTCGACGTATTCGGTGATGGCAAGAAAGTTTCTACACATATTGTGGAAAGTTTCATGGCA
GAGGAAAGGTTCCCAAATGGCTACGTCCCGAAGTTGTTGCGCACGAATAAACCAGGAGAGAGTTTGAGTCTTCTCGGAAGCTGGAGCAAAGCGTTTGCTGTATCTGTGGCAATGGCGAAG
GCTGAGAAGGAGATGGCGGGAGAGGAGTTCAAGACTACGGCGATCACTAAAGCTACAGAGAAGGTGTTGGCTGCTGCAGATAATGTCCCTCGCAAGGTGGGGAACAGGACTCAACAACTT
TACGAGAAGCTTGATCCTGTTTGTGATGGTTTGTCTGGCGAGAAAGATTTGTG

Retrieve as FASTA