Entry information : SAcoKat01
Entry ID 11215
Creation 2012-07-19 (Christophe Dunand)
Last sequence changes 2012-07-19 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: SAcoKat01
Name SAcoKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Ascomycota Saitoella
Organism Saitoella complicata    [TaxId: 5606 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SAcoKat01
start..stop
S start..stop
NcKat04 776 0 4..500 3..501
CnKat04_grubiiH99 579 0 8..492 6..496
CnKat04_B-3501A 577 0 8..492 6..496
CnKat04_JEC21 577 0 8..492 6..496
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 357..365 9 N° 2 703..878 176 N° 3 940..2290 1351  
join(357..365,703..878,940..2290)


exon

Literature and cross-references SAcoKat01
DNA ref. JGI genome:   scaffold_3 (357..2290)
Cluster/Prediction ref. JGI gene:   33250
Protein sequence: SAcoKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   512
PWM (Da):   %s   57339.71  
PI (pH):   %s   6.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSRNNDPPVYTLAEGRPVQDPTASMVLLGDAGKVKGGGLALLADTQLIEALAHFPRERIPERVVHAKAAGAWGEFECTKDITDWCSAAIFSSVGKKTEVLARISTVAGERGSSDTLRDIRGFAVKFKTEEGNYDIVGNDLPVFFIRDPAKFPSLNRSHKRHPQSGVADASMFWDFHNHNQEGVHCLMQLFGPRGVPKSLRNVNAFGNHTFKFGKPEDGSFRYVKIHFKPVDGIKNLTEEEAVKLAGTEPDYHIKDMYNSIERGDFPQWKMMLQVMTPKEAETFRYNIFDITKVWPHSEYPLQEVGILTLNRNADNYFAEIEQAAFSPSTLIPGIAPSADLMLHARMFSYPDAARYRVGPNYQQLPCNAAKNVYSPYQRDGPMRLDGNYGADPDYVRSSFRTIRCGPADVAHSEWVGRVQSYSSDVEPIDWEQPRALWALFKKNGEDEVFVRNLAGHVNKALPEVQKGTVEMFAKVDGEIGRRLGEALEMLGENVDHRKAPPSQTVLDRNRR*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAAGGGTGCGATACCAAGGGAACATGTTGGAGAGTCATTCCTCGCAGATGTGTCATCAACATGGATTCCCACAGAGTCCCAAGCGTGGCGCAGCGGTCAGCCCAGCCACACCGCTG
CCGAGCTGTCATCGGCAAATTCGGCACGGCAAAGCGGAAAGTATGGGTATCACGGTCATGGTGACATCATGACGAGAGCGACGGAGTTTGATAAGTCGCTCTCTCCTTCCCGGGATTGTT
GGCTCTGATTCACAACGAAATATCATCATGACTGGAACTGGAGTTGACGTGAGTGCATGAACCTTCCATGAACTGGGACGGACGTTGACTGACGCTGATTACCCAGAACAATGATCCGCC
TGTGTACACCCTCGCGGAGGGGCGACCAGTGCAAGACCCGACCGCCTCGATGGTCCTCCTCGGCGATGCCGGGAAGGTCAAGGGTGGTGGCCTCGCACTCCTCGCAGACACGCAGTTGAT
CGAGGCGCTCGCACACTTTCCCCGAGAGCGAATCCCCGAACG
GTGAGATTAAACCTAATTATTCAGCCTATGGCCATTGAATGAATGCTAACCTATGTCATAGTGTCGTCCACGCAAAGG
CTGCCGGCGCATGGGGTGAATTCGAGTGCACAAAGGACATCACAGACTGGTGCTCCGCCGCCATCTTCAGCAGCGTCGGCAAGAAGACCGAGGTCCTCGCTCGTATCTCCACCGTTGCCG
GCGAACGCGGGTCCTCCGATACCCTCCGCGACATCCGCGGTTTCGCCGTCAAGTTCAAGACCGAGGAAGGCAACTACGACATCGTCGGTAATGACCTCCCTGTTTTCTTCATCCGCGACC
CGGCAAAATTCCCCTCGCTTAACCGCTCCCATAAGCGACACCCCCAGAGCGGCGTTGCGGATGCCAGCATGTTTTGGGATTTCCACAACCATAATCAGGAGGGTGTTCATTGTTTAATGC
AACTCTTCGGACCGCGCGGTGTGCCCAAGTCCCTTCGCAACGTAAACGCCTTTGGCAACCACACTTTCAAGTTCGGCAAGCCCGAGGACGGATCGTTCAGATACGTCAAAATCCACTTCA
AGCCCGTCGACGGTATCAAGAACCTGACCGAAGAGGAGGCCGTCAAACTCGCGGGCACCGAACCGGATTACCACATCAAGGACATGTACAACTCCATCGAGCGCGGTGACTTTCCTCAGT
GGAAGATGATGCTCCAAGTCATGACCCCCAAAGAAGCCGAAACCTTCCGCTATAACATCTTCGACATCACAAAAGTCTGGCCCCACTCCGAATACCCCCTCCAAGAAGTCGGAATCCTCA
CCCTCAATCGCAACGCAGACAACTACTTTGCCGAAATCGAGCAAGCCGCGTTCTCCCCCTCCACGCTCATTCCCGGAATCGCACCCTCGGCGGACTTGATGTTGCATGCACGTATGTTCT
CATACCCAGACGCAGCCCGTTACAGGGTCGGACCAAACTACCAACAACTCCCCTGCAACGCCGCCAAAAACGTTTACTCCCCCTACCAGCGCGACGGCCCTATGCGCCTCGACGGCAACT
ACGGCGCGGACCCCGACTACGTCCGTTCCTCCTTCCGCACGATCCGCTGCGGTCCCGCCGACGTCGCGCACTCCGAATGGGTCGGGCGGGTCCAATCCTACTCCTCCGACGTCGAACCCA
TCGATTGGGAACAACCCCGCGCGCTCTGGGCCCTGTTTAAGAAGAATGGCGAAGATGAGGTCTTTGTAAGGAATTTGGCGGGACATGTTAATAAGGCGTTGCCGGAGGTGCAGAAGGGGA
CGGTGGAGATGTTTGCGAAGGTTGATGGGGAGATTGGGAGGAGACTTGGGGAGGCGTTGGAGATGTTGGGTGAGAATGTGGATCATAGGAAGGCGCCGCCTAGTCAGACTGTCTTGGATA
GGAATCGCAGGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAAGGAACAATGATCCGCCTGTGTACACCCTCGCGGAGGGGCGACCAGTGCAAGACCCGACCGCCTCGATGGTCCTCCTCGGCGATGCCGGGAAGGTCAAGGGTGGTGGCCTCGCA
CTCCTCGCAGACACGCAGTTGATCGAGGCGCTCGCACACTTTCCCCGAGAGCGAATCCCCGAACG
TGTCGTCCACGCAAAGGCTGCCGGCGCATGGGGTGAATTCGAGTGCACAAAGGAC
ATCACAGACTGGTGCTCCGCCGCCATCTTCAGCAGCGTCGGCAAGAAGACCGAGGTCCTCGCTCGTATCTCCACCGTTGCCGGCGAACGCGGGTCCTCCGATACCCTCCGCGACATCCGC
GGTTTCGCCGTCAAGTTCAAGACCGAGGAAGGCAACTACGACATCGTCGGTAATGACCTCCCTGTTTTCTTCATCCGCGACCCGGCAAAATTCCCCTCGCTTAACCGCTCCCATAAGCGA
CACCCCCAGAGCGGCGTTGCGGATGCCAGCATGTTTTGGGATTTCCACAACCATAATCAGGAGGGTGTTCATTGTTTAATGCAACTCTTCGGACCGCGCGGTGTGCCCAAGTCCCTTCGC
AACGTAAACGCCTTTGGCAACCACACTTTCAAGTTCGGCAAGCCCGAGGACGGATCGTTCAGATACGTCAAAATCCACTTCAAGCCCGTCGACGGTATCAAGAACCTGACCGAAGAGGAG
GCCGTCAAACTCGCGGGCACCGAACCGGATTACCACATCAAGGACATGTACAACTCCATCGAGCGCGGTGACTTTCCTCAGTGGAAGATGATGCTCCAAGTCATGACCCCCAAAGAAGCC
GAAACCTTCCGCTATAACATCTTCGACATCACAAAAGTCTGGCCCCACTCCGAATACCCCCTCCAAGAAGTCGGAATCCTCACCCTCAATCGCAACGCAGACAACTACTTTGCCGAAATC
GAGCAAGCCGCGTTCTCCCCCTCCACGCTCATTCCCGGAATCGCACCCTCGGCGGACTTGATGTTGCATGCACGTATGTTCTCATACCCAGACGCAGCCCGTTACAGGGTCGGACCAAAC
TACCAACAACTCCCCTGCAACGCCGCCAAAAACGTTTACTCCCCCTACCAGCGCGACGGCCCTATGCGCCTCGACGGCAACTACGGCGCGGACCCCGACTACGTCCGTTCCTCCTTCCGC
ACGATCCGCTGCGGTCCCGCCGACGTCGCGCACTCCGAATGGGTCGGGCGGGTCCAATCCTACTCCTCCGACGTCGAACCCATCGATTGGGAACAACCCCGCGCGCTCTGGGCCCTGTTT
AAGAAGAATGGCGAAGATGAGGTCTTTGTAAGGAATTTGGCGGGACATGTTAATAAGGCGTTGCCGGAGGTGCAGAAGGGGACGGTGGAGATGTTTGCGAAGGTTGATGGGGAGATTGGG
AGGAGACTTGGGGAGGCGTTGGAGATGTTGGGTGAGAATGTGGATCATAGGAAGGCGCCGCCTAGTCAGACTGTCTTGGATAGGAATCGCAGGTAG

Retrieve as FASTA