Entry information : LuPrx03 (FLXPER3|Lus10028735|PACid:23164544)
Entry ID 113
Creation 2006-06-19 (Christophe Dunand)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-19 (Christophe Dunand)
Peroxidase information: LuPrx03 (FLXPER3|Lus10028735|PACid:23164544)
Name (synonym) LuPrx03 (FLXPER3|Lus10028735|PACid:23164544)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation Cell wall
Tissue types Leaves
Seedlings
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx03
start..stop
S start..stop
LuPrx156 684 0 1..357 1..357
PtPrx67 501 5e-180 8..356 11..353
BvPrx25 492 3e-176 5..348 2..343
CroPrx03-1A_other 489 4e-175 29..356 40..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1126241..1126480 240 N° 2 1125360..1125557 198 N° 3 1124865..1125260 396 N° 4 1124261..1124500 240
complement(join(1124261..1124500,1124865..1125260,1125360..1125557,1126241..1126 480))


exon

Literature and cross-references LuPrx03 (FLXPER3|Lus10028735|PACid:23164544)
Literature Day A, Fénart S, Neutelings G, Hawkins S, Rolando C, Tokarski C. Identification of cell wall proteins in the flax (Linum usitatissimum) stem. Proteomics. 2013 13(5):812-25.
Protein ref. UniProtKB:   Q43782
DNA ref. Phytozome 12:   scaffold346 (1126480..1124261)
mRNA ref. GenBank:   U59284
Protein sequence: LuPrx03 (FLXPER3|Lus10028735|PACid:23164544)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   357 (331)
PWM (Da):   %s   38241.47 (35670.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.74 (7.72) Peptide Signal:   %s   cut: 27 range:27-357
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPTSSHVVALTIMLSAVLFASTATAQIPAPAKGMSWTFYKSSCPKLESIITKRLKEVFKKDIGQAAGLLRLHFHDCFVEGCDGSVLLTGSAGGPSAEQGSPPNLSLRKEAFRIIDDLRARVHKECGRVVSCSDIVAIAARDSVVLSGGPKYQVALGRRDGTTLVTQDTTLANLPPPFATTGTILSSLATKNLNPTDAVALSGAHTIGISHCSSFTDRLYPNQDPSMDQTFAKNLKATCPQAATTDNIVNQDIRSPNVFDNKYYVDLMNRQGLFTSDQDLYTDSRTRGIVTSFAINQTLFFEKFVVAMIKMGQISVLTGKQGEIRANCSLTNSAKVQTSSFLEEAVEEAVELLAGMR*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 2 ESTs. Experimental evidency of cell wall localization. Cultivar="Stormont cirrus".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCCACTTCTTCCCATGTCGTCGCTCTAACGATCATGTTGTCGGCGGTGTTGTTCGCATCCACGGCGACGGCTCAGATTCCGGCGCCGGCGAAAGGAATGTCGTGGACTTTCTAC
AAGTCCTCCTGCCCCAAGCTCGAGTCCATCATCACTAAGCGCCTCAAGGAAGTGTTCAAGAAGGACATCGGCCAGGCCGCAGGCTTGCTCCGCCTCCACTTCCATGACTGCTTCGTCGAG
GTACACATAAAATTTCGTCACTTTGGAATCAGGAAATCTTGTCATCTAAGTTCGTCTACTCTTGATTTCGCCATTTTTTGCTGGCTAAGAGCCCTGATTACTCATAATGATTCCTGATTC
CGCCATTTGTTGCTGACTAAGAGCCATGATTACTCATAATTACTAGCTTCTAGTGTAGATGGATTTTTATTTTTAACTGGGTTGTTGAAAATTCAAAAATATAATTTTTTTCTCTCTTGT
AGCTAGAATTATTAAATGTGGGGTTGTTGTACTATTACTAGTATTATTGTGTCAAATATTATTCAAATGTGACATATCAAGAATTTAGTGGAATGAATGATTAGGATTTTCTAATTTGAG
TTTTCATAGTCGAGCTGGTAATTAAATTAGGTAATATATCATATATTAGATGTATTGAATTTGAATAATATTTTTTGTGAAATGGTTGGTACTCGTGTGGACGTTTTAGATGGCCACTCG
TGTATGTGCTTCGTTATTCATGTTCGGAGCATTAAAATTAGTTAATTATTTGATATGGAAACATCAATAATTCATATAGTTCCATACAACCACCAAGTTATGGAGAAATAAATTCTATGG
ATGGTGAAGGAAATCTGGCTATGGATATTTTGTTGTATGGGAAATCAAAATAATTTTATTTTATTTATTATAATTATTTTCAGGGATGTGATGGATCGGTGTTGCTGACTGGATCGGCAG
GTGGGCCCAGCGCGGAGCAAGGGTCCCCACCTAACTTGAGCCTGAGGAAAGAAGCCTTCCGAATCATCGACGACCTCCGTGCACGTGTCCACAAGGAGTGCGGCCGCGTCGTCTCTTGCT
CCGACATTGTCGCTATAGCTGCCCGTGACTCCGTCGTCCTG
GTAAAATCGAGTCGAACGAATTTGGTTAGATAGAATTTATCGATTTCCTTTCCGGTTTAATTTAATGTAACTAATGTGT
GTATTTTTTTTATTCCATAGTCTGGTGGGCCAAAGTACCAAGTGGCGTTAGGCCGCCGCGACGGTACAACGTTAGTAACACAAGACACCACCTTGGCCAACCTCCCGCCCCCGTTTGCCA
CTACGGGAACCATCCTGAGCTCCCTCGCCACCAAGAACCTCAACCCGACCGACGCGGTCGCACTGTCTGGGGCCCACACCATCGGGATCAGCCACTGCTCCTCCTTCACCGACCGCCTCT
ACCCTAACCAGGATCCCTCCATGGACCAGACCTTCGCCAAAAACCTCAAGGCCACGTGTCCTCAGGCTGCCACGACCGACAACATTGTCAACCAGGACATTCGGTCCCCGAACGTGTTCG
ACAACAAGTATTATGTTGACTTGATGAACCGACAGGGCCTCTTCACCTCCGACCAG
GTATGGTTTGGTTCCTATTCGGATATTTGATATTAGTTTATAAATATTCTAATTAATTTGAAGG
ACAGAAGAATTATTTATTCAAGTATTTTTCAAACATTTAAACTTTATGAATCATTAATAAAGCTTTCTCAAGTTATGCAACTTAACCTTTTTATTTCATACTTCATAACTACAAAATAAA
ACAAACTATTCTAAATATAAAATATCTTGTCACAAAAATATTTTCAATCGAAATTTAATTGACTTATCAACTTCGGGTATAGTTTTTGAATGAATACTTCAATATTTATTCCCTACCTCG
TACATAAACTTTTTTGAGTAACCATAACTAACGGTTTATAATTGCAATCTCTACGACCAGGACTTATACACCGACTCGCGAACCCGTGGGATTGTTACAAGTTTCGCGATCAACCAGACC
CTGTTTTTCGAGAAGTTTGTCGTGGCTATGATCAAGATGGGGCAGATAAGCGTGTTGACCGGTAAACAAGGGGAGATCAGAGCTAACTGTTCGCTAACGAACTCCGCGAAGGTACAAACG
TCTTCGTTCTTGGAGGAAGCTGTGGAGGAGGCTGTCGAGCTTTTGGCTGGGATGAGATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCCCACTTCTTCCCATGTCGTCGCTCTAACGATCATGTTGTCGGCGGTGTTGTTCGCATCCACGGCGACGGCTCAGATTCCGGCGCCGGCGAAAGGAATGTCGTGGACTTTCTAC
AAGTCCTCCTGCCCCAAGCTCGAGTCCATCATCACTAAGCGCCTCAAGGAAGTGTTCAAGAAGGACATCGGCCAGGCCGCAGGCTTGCTCCGCCTCCACTTCCATGACTGCTTCGTCGAG
GGATGTGATGGATCGGTGTTGCTGACTGGATCGGCAGGTGGGCCCAGCGCGGAGCAAGGGTCCCCACCTAACTTGAGCCTGAGGAAAGAAGCCTTCCGAATCATCGACGACCTCCGTGCA
CGTGTCCACAAGGAGTGCGGCCGCGTCGTCTCTTGCTCCGACATTGTCGCTATAGCTGCCCGTGACTCCGTCGTCCTG
TCTGGTGGGCCAAAGTACCAAGTGGCGTTAGGCCGCCGCGAC
GGTACAACGTTAGTAACACAAGACACCACCTTGGCCAACCTCCCGCCCCCGTTTGCCACTACGGGAACCATCCTGAGCTCCCTCGCCACCAAGAACCTCAACCCGACCGACGCGGTCGCA
CTGTCTGGGGCCCACACCATCGGGATCAGCCACTGCTCCTCCTTCACCGACCGCCTCTACCCTAACCAGGATCCCTCCATGGACCAGACCTTCGCCAAAAACCTCAAGGCCACGTGTCCT
CAGGCTGCCACGACCGACAACATTGTCAACCAGGACATTCGGTCCCCGAACGTGTTCGACAACAAGTATTATGTTGACTTGATGAACCGACAGGGCCTCTTCACCTCCGACCAG
GACTTA
TACACCGACTCGCGAACCCGTGGGATTGTTACAAGTTTCGCGATCAACCAGACCCTGTTTTTCGAGAAGTTTGTCGTGGCTATGATCAAGATGGGGCAGATAAGCGTGTTGACCGGTAAA
CAAGGGGAGATCAGAGCTAACTGTTCGCTAACGAACTCCGCGAAGGTACAAACGTCTTCGTTCTTGGAGGAAGCTGTGGAGGAGGCTGTCGAGCTTTTGGCTGGGATGAGATAA

Retrieve as FASTA