Entry information : OsPrx136(LOC_Os12g02060)
Entry ID 1146
Creation 2006-07-26 (Filippo Passardi)
Last sequence changes 2010-08-03 (Marie Brette)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2022-02-10 (Christophe Dunand)
Peroxidase information: OsPrx136(LOC_Os12g02060)
Name OsPrx136(LOC_Os12g02060)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx136
start..stop
S start..stop
OsPrx131 622 0 1..317 1..317
SiPrx61 594 0 1..317 1..317
SbPrx86 578 0 1..317 1..317
OsPrx57 474 2e-170 3..317 4..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 613316..613525 210 N° 2 613611..613802 192 N° 3 614067..614232 166 N° 4 614460..614845 386
join(613316..613525,613611..613802,614067..614232,614460..614845)


exon

Literature and cross-references OsPrx136(LOC_Os12g02060)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1F7
DNA ref. GenBank:   NC_008405.1 (613316..614842)
Protein sequence: OsPrx136(LOC_Os12g02060)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (294)
PWM (Da):   %s   33719.69 (31445.5)  
PI (pH):   %s   7.68 (7.36) Peptide Signal:   %s   cut: 24 range:24-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASPKPFACSAIALLFAANLVSAQLSANFYDKSCPNALPTIRIAVRSAIARENRMGASLLRLHFHDCFVNGCDGSVLLDDTPTFTGEKTAAPNNNSLRGFDVIDNIKAHIEGICPQVVSCADILAVAARESVVALGGPTWVVQLGRRDSTTASLDTANNDIPAPTFDLGDLTKSFSNKGLSATDMIALSGAHTIGQARCVNFRNRIYSETNIDTSLATSLKSNCPNTTGDNNISPLDASTPYAFDNFYYKNLLNKKGVLHSDQQLFNGGSADSQTTTYSSNMATFFTDFSAAMVKMGNINPITGSSGQIRKNCRKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 12, 3 introns). No EST found.. Incorrect prediction from Phytozome (end of exon 1 is missing)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCCTAAACCCTTTGCTTGCAGTGCCATTGCCTTGTTATTTGCTGCAAACTTGGTGTCAGCTCAGCTTAGCGCAAATTTCTATGACAAATCATGCCCTAATGCACTGCCCACC
ATCCGAATAGCCGTGAGATCTGCCATCGCAAGGGAGAACCGCATGGGTGCATCATTGCTCCGCCTCCACTTCCACGACTGCTTTGTCAAT
GAAAGTGTCCTGAACCTGCAGAGATATTCA
AAATTTTCTCACTTCTAAGTATTACGTAATAACCTTCAGTATTCTGACAATGCAGGGTTGTGATGGCTCGGTGCTGCTAGATGACACTCCAACATTCACTGGAGAGAAGACCGCTGCTCC
AAACAACAACTCTCTGCGTGGATTTGATGTTATAGACAACATCAAGGCACATATTGAGGGGATCTGTCCGCAGGTGGTCTCATGTGCTGACATCCTTGCTGTGGCGGCACGCGAATCTGT
TGTTGCG
GTAAGGGGAGAAAATACAAAGGATATCAAACTAAAAGTTAGTTATTTGTCTGTCTTAAAAAGTTAACAGGAACTCCTGACGTCAGAAGATGAGCAACTGAAATGAACAAAACA
TAACTCTTTATGTATAGCTATGAAATTCTATACCAAAACAAGCCTTACAAAGTATTAAAAGTCAAGTTGCCAAAGATAGTAAAATAAATTAATTGATATTTATAAAATACAATCAGTAGT
GACATATGAAAACCGACAATTTATTTTTCAGCTAGGAGGTCCTACTTGGGTTGTCCAGCTGGGACGGCGCGACTCAACAACAGCAAGCCTGGATACTGCAAACAATGACATTCCAGCTCC
AACCTTTGACCTTGGTGATCTCACGAAGTCTTTTTCAAACAAAGGACTAAGCGCAACTGACATGATTGCACTCTCAG
GTACTGTGTATGTAAATGGAACTTTTTGGTATATAATACCATC
TATAATAAAACCATAAAATAAAACAGCTATCCTTGCTGAAGCTTGATTGTCAAAACAAACTGTACAAGTGGTGTTACATTTATGTAGGAGTATCAATATATCATGGTGCAACCCCAACAG
GTTGTTTAGTATCAAGATGCTACTGATCAATTGATCACTAACATCAAATAAAAATATATGCCAGGGGCTCACACCATAGGCCAGGCAAGGTGCGTCAATTTTCGCAACCGCATCTACAGT
GAGACCAACATCGACACTTCCCTGGCAACATCTCTGAAATCAAATTGTCCAAACACGACTGGCGACAACAACATATCCCCCCTTGATGCATCGACGCCCTACGCCTTTGACAATTTTTAC
TACAAGAACCTGCTGAACAAGAAGGGTGTCCTGCATTCTGACCAGCAACTATTCAATGGTGGTTCAGCAGATTCCCAGACGACCACCTACTCATCAAACATGGCAACATTCTTCACTGAT
TTCAGCGCAGCAATGGTGAAGATGGGCAACATCAACCCCATTACTGGATCTAGTGGACAGATCAGGAAGAACTGCAGGAAGGTAAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCCTAAACCCTTTGCTTGCAGTGCCATTGCCTTGTTATTTGCTGCAAACTTGGTGTCAGCTCAGCTTAGCGCAAATTTCTATGACAAATCATGCCCTAATGCACTGCCCACC
ATCCGAATAGCCGTGAGATCTGCCATCGCAAGGGAGAACCGCATGGGTGCATCATTGCTCCGCCTCCACTTCCACGACTGCTTTGTCAAT
GGTTGTGATGGCTCGGTGCTGCTAGATGAC
ACTCCAACATTCACTGGAGAGAAGACCGCTGCTCCAAACAACAACTCTCTGCGTGGATTTGATGTTATAGACAACATCAAGGCACATATTGAGGGGATCTGTCCGCAGGTGGTCTCATGT
GCTGACATCCTTGCTGTGGCGGCACGCGAATCTGTTGTTGCG
CTAGGAGGTCCTACTTGGGTTGTCCAGCTGGGACGGCGCGACTCAACAACAGCAAGCCTGGATACTGCAAACAATGAC
ATTCCAGCTCCAACCTTTGACCTTGGTGATCTCACGAAGTCTTTTTCAAACAAAGGACTAAGCGCAACTGACATGATTGCACTCTCAG
GGGCTCACACCATAGGCCAGGCAAGGTGCGTC
AATTTTCGCAACCGCATCTACAGTGAGACCAACATCGACACTTCCCTGGCAACATCTCTGAAATCAAATTGTCCAAACACGACTGGCGACAACAACATATCCCCCCTTGATGCATCGACG
CCCTACGCCTTTGACAATTTTTACTACAAGAACCTGCTGAACAAGAAGGGTGTCCTGCATTCTGACCAGCAACTATTCAATGGTGGTTCAGCAGATTCCCAGACGACCACCTACTCATCA
AACATGGCAACATTCTTCACTGATTTCAGCGCAGCAATGGTGAAGATGGGCAACATCAACCCCATTACTGGATCTAGTGGACAGATCAGGAAGAACTGCAGGAAGGTAAACTAG

Retrieve as FASTA