Entry information : ZmPrx[P]110 (GRMZM2G004984)
Entry ID 1153
Creation 2007-11-12 (Christophe Dunand)
Last sequence changes 2011-01-25 (Christophe Dunand)
Sequence status theoretical translation / pseudogene
Reviewer Qiang Li
Last annotation changes 2011-07-03 (Qiang Li)
Peroxidase information: ZmPrx[P]110 (GRMZM2G004984)
Name (synonym) ZmPrx[P]110 (GRMZM2G004984)
Class Class III peroxidase     [Orthogroup: Prx075]*
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Roots
Inducer Salt stress
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx[P]110
S start..stop
ZmPrx145 548 0 1..278 1..278
ZmPrx144 518 0 1..278 1..279
SbPrx15 487 1e-175 2..278 3..274
SiPrx155 435 2e-155 1..278 1..262
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 63676620..63676868 249 N° 2 63677007..63677645 639  


Literature and cross-references ZmPrx[P]110 (GRMZM2G004984)
Literature Walbot,V., unpublished
EST ref. GenBank:   AI649511.1
Protein sequence: ZmPrx[P]110 (GRMZM2G004984)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   295 (269)
PWM (Da):   %s   30606.4 (28105.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.98 (6.77) Peptide Signal:   %s   cut: 27 range:27-295
Send to BLAST
Send to Peroxiscan

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 1, intron 1) and 1 EST (confirm the lack of the 3' end). The regular sequence is present (end position 63677769) and without the (C) the traduction is correct TC(C)ACGTCGGACGCCACACTCCTCACGTCGCCGGCGACGGCGAAGCTGGTGGATGACAACGCCAACGTCCCCGGGTGGTGGGAGGACAGCTTCAAGGTGGCCATGGTGAAGATGGCCAGTGTCGAGGTGAAGACCGGCAATAGCGGCGAGATCAGGAGGAACTGCCGTCTCGTCAACTAG. Gene in way to be a pseudogene!!!
Send to BLAST

Retrieve as FASTA  
Send to BLAST

Retrieve as FASTA