Entry information : ZmPrx88 (GRMZM2G410175[6a] / peroxidaseR15)
Entry ID 1160
Creation 2007-02-09 (Christophe Dunand)
Last sequence changes 2011-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-07-02 (Christophe Dunand)
Peroxidase information: ZmPrx88 (GRMZM2G410175[6a] / peroxidaseR15)
Name (synonym) ZmPrx88 (GRMZM2G410175[6a] / peroxidaseR15)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Roots
Seedlings
Inducer Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx88
start..stop
S start..stop
ZmPrx[P]148 588 0 31..323 1..294
ZmPrx[P]147 588 0 31..323 1..294
SbPrx126 569 0 20..323 23..326
ZmPrx[P]149 565 0 41..323 1..284
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 156550679..156550876 198 N° 2 156550990..156551178 189 N° 3 156551272..156551856 585  
join(156550679..156550876,156550990..156551178,156551272..156551856)


exon

Literature and cross-references ZmPrx88 (GRMZM2G410175[6a] / peroxidaseR15)
Literature Padegimas,L.S. and Reichert,N.A. Isolation of genes and regulatory sequences implicated in hypersensitive response from Zea mays line MP307.
Protein ref. UniProtKB:   Q9ZTT2
Cluster/Prediction ref. UniGene:   Zm.82158
Protein sequence: ZmPrx88 (GRMZM2G410175[6a] / peroxidaseR15)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (304)
PWM (Da):   %s   34917.46 (33058.5)  
PI (pH):   %s   6.62 (6.62) Peptide Signal:   %s   cut: 20 range:20-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASWAALLALLLSAFSAAAQLDERFYGQSCPSVEDVVRKEMVRALSVAPSLAGPLLRMHFHDCFVRGCDGSVLLDSTANNTAEKDAKPNLTLRGFGFIERVKAAVEKACPDTVSCADVLALMARDAVWLSKGPFWAVPLGRRDGRVSISNETDQLPPPTGNFTELAQLFGAKGLDTRDLAVLSAGHTIGTSHCFSFSDRLYNFTGLDDARDTDPELDRAYMARLRAKCASLDDNTTLVEMDPGSFRTFDLGYYANVAKRRGLFHSDAQLLADPSTRAYVLRHATGAHRDEFFADFAASMVKMGSVGVLTGGQGEVRKKCNVVN*

Retrieve as FASTA  
Remarks Complete sequence from Genomic (chromo 6, intron 1 and 2), 1 cDNA and 4 EST. Strain="B73", "F2".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCTGGGCGGCTCTCCTGGCGCTGCTGCTCTCGGCGTTCTCGGCGGCGGCGCAGCTGGACGAGAGGTTCTACGGCCAGTCGTGCCCCAGCGTGGAGGACGTCGTGCGGAAGGAG
ATGGTGCGCGCGCTCTCCGTCGCGCCCAGCCTCGCCGGGCCGCTCCTCAGGATGCACTTCCACGACTGCTTCGTCAGG
GTACGTACGGTTTGCGTTTCTACTGTAGCGCGCGGCTTCGAT
ATATGCACTTCTTGTAGGCTTGCATTGCTAGCTATAGCTAGCTAACCCGTCCCGTACGTGTGTGTGTGCAGGGGTGCGACGGCTCGGTGCTCCTCGACTCCACGGCGAACAACACCGCGG
AGAAGGACGCGAAGCCGAACCTGACGCTGCGCGGCTTCGGCTTCATCGAGAGGGTCAAGGCCGCGGTGGAGAAGGCGTGCCCTGACACCGTCTCCTGCGCCGACGTGCTGGCTCTCATGG
CCAGGGACGCAGTGTGGCTG
GTACGTCGTACTACGTACCAAAGCATGCATATACGTACGTTATTATGAGAATCTCTTCTTACTGGCTACCTGTTGTTGTTCTCACTCGCTCAGAGCAAGG
GCCCGTTCTGGGCGGTCCCACTGGGGCGGCGGGACGGCAGGGTGTCCATCTCCAACGAGACCGACCAGCTGCCGCCGCCCACGGGCAACTTCACGGAGCTGGCCCAGCTGTTCGGCGCCA
AGGGCCTGGACACCAGGGACCTGGCGGTGCTGTCGGCCGGCCACACCATCGGCACGTCGCACTGCTTCTCCTTCTCGGACCGCCTCTACAACTTCACGGGCCTGGACGACGCCCGCGACA
CCGACCCGGAGCTGGACCGCGCGTACATGGCGCGCCTCCGCGCCAAGTGCGCCAGCCTGGACGACAACACCACCCTGGTGGAGATGGACCCCGGCAGCTTCCGCACCTTCGACCTGGGCT
ACTACGCCAACGTGGCCAAGCGCAGGGGCCTCTTCCACTCCGACGCCCAGCTGCTCGCCGACCCTTCCACCCGCGCCTACGTGCTCCGCCACGCCACGGGCGCCCACAGGGACGAGTTCT
TCGCCGACTTCGCCGCGTCCATGGTCAAGATGGGCTCCGTCGGCGTGCTCACCGGCGGCCAGGGCGAGGTCAGGAAGAAGTGCAACGTCGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCTGGGCGGCTCTCCTGGCGCTGCTGCTCTCGGCGTTCTCGGCGGCGGCGCAGCTGGACGAGAGGTTCTACGGCCAGTCGTGCCCCAGCGTGGAGGACGTCGTGCGGAAGGAG
ATGGTGCGCGCGCTCTCCGTCGCGCCCAGCCTCGCCGGGCCGCTCCTCAGGATGCACTTCCACGACTGCTTCGTCAGG
GGGTGCGACGGCTCGGTGCTCCTCGACTCCACGGCGAACAAC
ACCGCGGAGAAGGACGCGAAGCCGAACCTGACGCTGCGCGGCTTCGGCTTCATCGAGAGGGTCAAGGCCGCGGTGGAGAAGGCGTGCCCTGACACCGTCTCCTGCGCCGACGTGCTGGCT
CTCATGGCCAGGGACGCAGTGTGGCTG
AGCAAGGGCCCGTTCTGGGCGGTCCCACTGGGGCGGCGGGACGGCAGGGTGTCCATCTCCAACGAGACCGACCAGCTGCCGCCGCCCACGGGC
AACTTCACGGAGCTGGCCCAGCTGTTCGGCGCCAAGGGCCTGGACACCAGGGACCTGGCGGTGCTGTCGGCCGGCCACACCATCGGCACGTCGCACTGCTTCTCCTTCTCGGACCGCCTC
TACAACTTCACGGGCCTGGACGACGCCCGCGACACCGACCCGGAGCTGGACCGCGCGTACATGGCGCGCCTCCGCGCCAAGTGCGCCAGCCTGGACGACAACACCACCCTGGTGGAGATG
GACCCCGGCAGCTTCCGCACCTTCGACCTGGGCTACTACGCCAACGTGGCCAAGCGCAGGGGCCTCTTCCACTCCGACGCCCAGCTGCTCGCCGACCCTTCCACCCGCGCCTACGTGCTC
CGCCACGCCACGGGCGCCCACAGGGACGAGTTCTTCGCCGACTTCGCCGCGTCCATGGTCAAGATGGGCTCCGTCGGCGTGCTCACCGGCGGCCAGGGCGAGGTCAGGAAGAAGTGCAAC
GTCGTCAACTAA

Retrieve as FASTA