Entry information : AwenCcP01
Entry ID 11720
Creation 2013-04-09 (Christophe Dunand)
Last sequence changes 2013-04-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: AwenCcP01
Name AwenCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP002]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Aspergillus
Organism Aspergillus wentii    [TaxId: 5066 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AwenCcP01
start..stop
S start..stop
AorCcP01 563 0 1..313 1..312
AflCcP01 563 0 1..313 1..312
AclCcP01 557 0 1..311 1..312
AteCcP01_NIH2624 556 0 1..313 1..305
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 558317..558426 110 N° 2 558501..559332 832  
join(558317..558426,558501..559332)


exon

Literature and cross-references AwenCcP01
DNA ref. JGI genome:   scaffold_1 (558317..559332)
Cluster/Prediction ref. JGI gene:   33541
Protein sequence: AwenCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   313 (505)
PWM (Da):   %s   34404.13 (52802.2)  
PI (pH):   %s   5.67 (4.39) Peptide Signal:   %s   cut: 25 range:25-529
Sequence 355
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSAGDYNAVKRDIVAQLKKPDYDDGSTGPVFVRLAWHASGTYDLETDTGGSNGAGMRYEAEGGDPANAGLQHGRAFLEPVKEKHPWITYSDLWTLAGVVAIKEMGGPDIAWKPGRTDLVDDSKVPPRGRLPDGAQGADHLRFIFYRMGFNDQEIVALAGGHNLGRCHADRSGFNGPWVNNPTRFSNQFFKLLLKLEWKPKTLENGVSQFVYEDPDAEEGDEQLMMLPTDVALLTDPAFSVWVKRYAEDKDLFFDHFSKVFAKLIELGIQRNEKEAIINTDNVKGGYISAPKKSNTPGASSGQGGGCPFRARL*

Retrieve as FASTA  
Remarks Complete sequence frpm genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAGCAGCGCCGGAGACTATAACGCCGTGAAAAGGGACATCGTGGCCCAACTGAAGAAGCCTGATTATGACGATGGCAGCACTGGCCCCGTGTTTGTGCGTCTGGCATGGTGAGTATTTT
CAACGCCCCTTGTTTCCCCGTCGGTTGTATCGTCGCCACTGACCGCGACCGTGTTTTCTGCAGGCACGCCTCCGGCACATACGATCTCGAGACCGACACAGGCGGTTCCAATGGCGCAGG
CATGCGATATGAAGCGGAGGGTGGCGACCCGGCCAACGCTGGTCTGCAGCACGGACGAGCTTTCCTAGAGCCCGTAAAGGAGAAGCACCCGTGGATCACATACTCGGACCTGTGGACATT
AGCAGGAGTAGTCGCAATCAAAGAGATGGGCGGACCCGATATCGCATGGAAACCCGGTCGGACCGATCTCGTCGATGACTCCAAGGTGCCACCCCGAGGCCGCCTTCCTGACGGTGCCCA
AGGCGCCGACCACCTCCGCTTCATCTTCTACCGTATGGGATTCAACGACCAGGAAATCGTCGCCTTGGCTGGAGGACACAACCTGGGCCGTTGCCACGCTGACCGTAGTGGATTCAACGG
CCCATGGGTGAACAACCCAACCCGGTTCTCGAACCAGTTCTTCAAGCTGCTCCTCAAGCTCGAATGGAAGCCCAAGACACTGGAAAACGGTGTCAGCCAATTCGTATATGAGGACCCCGA
TGCGGAAGAGGGCGATGAGCAGCTGATGATGCTACCCACCGACGTCGCTCTCCTCACCGACCCTGCCTTCTCAGTCTGGGTCAAGCGTTATGCCGAGGACAAGGACCTATTCTTCGACCA
TTTCTCCAAGGTATTTGCCAAGCTGATCGAGCTCGGAATCCAACGAAACGAGAAGGAGGCGATCATCAACACCGACAACGTCAAGGGAGGATATATCTCTGCGCCGAAGAAGAGCAACAC
CCCTGGTGCCTCATCGGGCCAGGGTGGTGGCTGTCCTTTCCGTGCTAGACTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAGCAGCGCCGGAGACTATAACGCCGTGAAAAGGGACATCGTGGCCCAACTGAAGAAGCCTGATTATGACGATGGCAGCACTGGCCCCGTGTTTGTGCGTCTGGCATGGCACGCCTCCG
GCACATACGATCTCGAGACCGACACAGGCGGTTCCAATGGCGCAGGCATGCGATATGAAGCGGAGGGTGGCGACCCGGCCAACGCTGGTCTGCAGCACGGACGAGCTTTCCTAGAGCCCG
TAAAGGAGAAGCACCCGTGGATCACATACTCGGACCTGTGGACATTAGCAGGAGTAGTCGCAATCAAAGAGATGGGCGGACCCGATATCGCATGGAAACCCGGTCGGACCGATCTCGTCG
ATGACTCCAAGGTGCCACCCCGAGGCCGCCTTCCTGACGGTGCCCAAGGCGCCGACCACCTCCGCTTCATCTTCTACCGTATGGGATTCAACGACCAGGAAATCGTCGCCTTGGCTGGAG
GACACAACCTGGGCCGTTGCCACGCTGACCGTAGTGGATTCAACGGCCCATGGGTGAACAACCCAACCCGGTTCTCGAACCAGTTCTTCAAGCTGCTCCTCAAGCTCGAATGGAAGCCCA
AGACACTGGAAAACGGTGTCAGCCAATTCGTATATGAGGACCCCGATGCGGAAGAGGGCGATGAGCAGCTGATGATGCTACCCACCGACGTCGCTCTCCTCACCGACCCTGCCTTCTCAG
TCTGGGTCAAGCGTTATGCCGAGGACAAGGACCTATTCTTCGACCATTTCTCCAAGGTATTTGCCAAGCTGATCGAGCTCGGAATCCAACGAAACGAGAAGGAGGCGATCATCAACACCG
ACAACGTCAAGGGAGGATATATCTCTGCGCCGAAGAAGAGCAACACCCCTGGTGCCTCATCGGGCCAGGGTGGTGGCTGTCCTTTCCGTGCTAGACTGTAA

Retrieve as FASTA