Entry information : ZcelCIIAC02
Entry ID 11843
Creation 2013-05-22 (Christophe Dunand)
Last sequence changes 2013-10-16 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-10-16 (Nizar Fawal)
Peroxidase information: ZcelCIIAC02
Name ZcelCIIAC02
Class Asco Class II type C    [Orthogroup: CIIAC001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Zasmidium
Organism Zasmidium cellare    [TaxId: 395010 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZcelCIIAC02
start..stop
S start..stop
MfiCIIAC01 335 3e-115 87..357 39..308
CfulCIIAC01 335 8e-115 86..356 58..328
MpiCIIAC01 320 5e-109 71..356 17..318
MfiCIIAC02 319 1e-108 86..356 49..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 126427..126787 361 N° 2 126117..126358 242 N° 3 125865..126063 199 N° 4 125641..125805 165
N° 5 125482..125588 107  
complement(join(125482..125588,125641..125805,125865..126063,126117..126358,1264 27..126787))


exon

Literature and cross-references ZcelCIIAC02
DNA ref. JGI genome:   scaffold_17 (126787..125482)
Cluster/Prediction ref. JGI gene:   54533
Protein sequence: ZcelCIIAC02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   358 (334)
PWM (Da):   %s   38033.97 (35311.5)  
PI (pH):   %s   7.75 (7.37) Peptide Signal:   %s   cut: 24 range:24-357
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFTRLSMLLFIAIIPTCLQFAQATQDANALVGLPRPDSTERTSPLDVDRLSSVLPIHDQNGSAPRSSKAIAELKSRAFGQQQRNRNCPAIWKTIAADLKLDFLGCNDHARSAVRFAFHDAAGYSSLNTLYGPASGGADGSLLLNDQEISRDANAPMKTFRDNLLLPKYNTYKSSGVGAADIVQFAGAIGVRSCPGGPRYKTVIGRTDDSNACPDGTLPAAFGANSSYSAIVQLFAQKGFNERDLAALLGAHSTSRAFAQQQNGIPSGRPQDSSPNVWDTAFYRQTQASQAPPGVYRFDSDVNVAQPETTCGKAFTDFGSSPPTVWATAFADAMYRLSVLGISKDVVSGLVDCTSAVL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCACTCGCTTGTCTATGTTGCTTTTCATTGCCATCATCCCTACTTGTCTCCAGTTTGCACAAGCAACACAGGATGCCAATGCTCTCGTAGGACTGCCGCGACCAGACTCAACAGAA
AGAACATCGCCGCTCGACGTGGATAGACTGAGCTCAGTCCTTCCGATCCACGACCAAAACGGCTCTGCACCGCGGTCGAGCAAGGCTATAGCAGAACTCAAGTCTAGAGCCTTCGGTCAG
CAACAGCGCAATAGGAACTGTCCCGCCATCTGGAAGACAATCGCTGCCGATCTCAAGCTGGATTTTCTGGGTTGCAATGACCATGCAAGATCAGCTGTTCGTTTTGCTTTCCACGATGCT
G
GTAAGAGTAGAGCCATAGCCAGAGCCACTGCTTTTATTAAGCAAGTAAAGCTAACAAGGCATATCAAGCTGGCTATTCATCACTCAATACCCTGTACGGCCCAGCAAGTGGAGGCGCCG
ATGGCTCGCTTCTCCTCAACGACCAGGAGATCTCTCGAGACGCCAACGCACCTATGAAGACGTTTCGAGATAATTTGCTTCTCCCAAAGTACAACACTTACAAGTCTTCTGGGGTTGGCG
CTGCAGACATTGTCCAGTTCGCGGGTGCTATCGGGGTGAGGAGCTGTCCCGGTGGGCCAAGATACAAGACA
GTGAGTCGGTGTGGCTGCATTCAGACGGTGGTCTGTGACTGATTATCGA
ACAGGTCATCGGTCGGACTGACGATAGCAACGCATGTCCAGACGGAACCTTGCCTGCTGCGTTTGGGGCGAATTCCTCGTACTCAGCGATAGTGCAGCTCTTTGCACAGAAGGGTTTCAA
TGAACGGGATTTGGCGGCACTGTTGGGTGCGCACTCCACATCAAGAGCTTTTGCTCAGCAGCAAAATGGGATTCCTTCTGGCC
GTGAGTGGTTTGGTCGAGGAATCTGCCAGAAAATGAA
CATTCTTAATAAACATGAACAGGTCCGCAAGACAGCTCGCCCAATGTGTGGGATACCGCCTTCTATCGACAGACACAAGCCTCTCAAGCGCCGCCAGGAGTGTATCGTTTCGATTCCGAC
GTGAACGTGGCACAGCCTGAGACCACGTGCGGTAAAGCGTTTACGGACTTTGGGAGCTCTCCGCCTA
GTAAGTCACTCCTTCTGAATCTGTCCATCGTTTCCAGCTGATATTGGCTCAGC
TGTCTGGGCTACAGCCTTCGCGGATGCTATGTACAGGTTGAGCGTACTTGGGATTTCGAAGGATGTTGTGTCCGGGCTCGTTGATTGCACAAGTGCTGTCCTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCACTCGCTTGTCTATGTTGCTTTTCATTGCCATCATCCCTACTTGTCTCCAGTTTGCACAAGCAACACAGGATGCCAATGCTCTCGTAGGACTGCCGCGACCAGACTCAACAGAA
AGAACATCGCCGCTCGACGTGGATAGACTGAGCTCAGTCCTTCCGATCCACGACCAAAACGGCTCTGCACCGCGGTCGAGCAAGGCTATAGCAGAACTCAAGTCTAGAGCCTTCGGTCAG
CAACAGCGCAATAGGAACTGTCCCGCCATCTGGAAGACAATCGCTGCCGATCTCAAGCTGGATTTTCTGGGTTGCAATGACCATGCAAGATCAGCTGTTCGTTTTGCTTTCCACGATGCT
G
CTGGCTATTCATCACTCAATACCCTGTACGGCCCAGCAAGTGGAGGCGCCGATGGCTCGCTTCTCCTCAACGACCAGGAGATCTCTCGAGACGCCAACGCACCTATGAAGACGTTTCGA
GATAATTTGCTTCTCCCAAAGTACAACACTTACAAGTCTTCTGGGGTTGGCGCTGCAGACATTGTCCAGTTCGCGGGTGCTATCGGGGTGAGGAGCTGTCCCGGTGGGCCAAGATACAAG
ACA
GTCATCGGTCGGACTGACGATAGCAACGCATGTCCAGACGGAACCTTGCCTGCTGCGTTTGGGGCGAATTCCTCGTACTCAGCGATAGTGCAGCTCTTTGCACAGAAGGGTTTCAAT
GAACGGGATTTGGCGGCACTGTTGGGTGCGCACTCCACATCAAGAGCTTTTGCTCAGCAGCAAAATGGGATTCCTTCTGGCC
GTCCGCAAGACAGCTCGCCCAATGTGTGGGATACCGCC
TTCTATCGACAGACACAAGCCTCTCAAGCGCCGCCAGGAGTGTATCGTTTCGATTCCGACGTGAACGTGGCACAGCCTGAGACCACGTGCGGTAAAGCGTTTACGGACTTTGGGAGCTCT
CCGCCTA
CTGTCTGGGCTACAGCCTTCGCGGATGCTATGTACAGGTTGAGCGTACTTGGGATTTCGAAGGATGTTGTGTCCGGGCTCGTTGATTGCACAAGTGCTGTCCTTTAG

Retrieve as FASTA