Entry information : GmarVP07
Entry ID 11916
Creation 2013-05-27 (Christophe Dunand)
Last sequence changes 2015-06-17 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2017-04-19 (Catherine Mathe (Scipio))
Peroxidase information: GmarVP07
Name GmarVP07
Class Versatile peroxidase    [Orthogroup: VP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Cortinariaceae Galerina
Organism Galerina marginata    [TaxId: 109633 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmarVP07
start..stop
S start..stop
PoVP04_PC15 315 1e-106 10..353 10..351
PoVP04_PC9 315 2e-106 10..343 10..341
PsaVP01 296 3e-99 10..353 10..355
PoVP01_PC9 295 1e-98 27..353 31..355
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 400238..400301 64 N° 2 400352..400470 119 N° 3 400519..400721 203 N° 4 400779..400907 129
N° 5 400960..401076 117 N° 6 401134..401214 81 N° 7 401271..401559 289 N° 8 401618..401686 69
join(400238..400301,400352..400470,400519..400721,400779..400907,400960..401076, 401134..401214,401271..401559,401618..401686)


exon

Literature and cross-references GmarVP07
DNA ref. JGI genome:   scaffold_38 (400238..401686)
Cluster/Prediction ref. JGI gene:   77799 [Incorrect prediction]
Protein sequence: GmarVP07
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   356 (335)
PWM (Da):   %s   37611.01 (35448.9)  
PI (pH):   %s   5.15 (5.15) Peptide Signal:   %s   cut: 22 range:22-356
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSGFILCSILLLGGLQQIGADVVPFTCSDGNTVKNKECCQLFPVLADLRALFRDDLCSPGGHGLLHLAFHDAIQFSKSDPKVGGGADGSILTFSNIEGAFPENVGVVQSTAALLHPLRSAHNISDGDLLHFAAAVAISSCSGAPRMRFLLGRPPAKAPARNGHMIPKATDSVKSVLQRFEAAGISASAVVALLAAHSTARNYVTDPSVIGAPLDSTPRVFDTQIFIETLLKGTRLAGTEGSDREAESALQGELRLRSDEQLARDPATSCFWQALAADQTLMENQFQSAMLQLQLLGQDTTTMIECSEVVPIPPPPPSQPHFPAGFSKFDIDQACATETFPSIPSLAGPRETVNLQ

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns). Incorrect prediction from JGI (first exon is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCCGGATTTATTTTGTGCTCAATTTTGCTTCTTGGAGGCTTGCAACAGATCGGAGCTGGTCAGTCGAACCTTCTCAAAATTCTGTGAAATGCAACTGAACGACTCCAGATGTCG
TTCCTTTCACCTGCAGTGATGGAAATACCGTGAAGAATAAAGAATGTTGTCAACTTTTCCCAGTCCTGGCCGACCTTCGAGCTCTGTTTCGAGACGACCTCTGTTCTCCTGGG
GTAAGCC
TGGAAACATATTTGATAGGCATATCTAACCGGACGCGCAAGGGGCATGGATTGCTTCATCTTGCGTTCCACGACGCGATCCAATTCTCTAAATCTGATCCGAAAGTTGGAGGAGGTGCAG
ATGGGTCCATTCTGACATTCAGCAACATCGAAGGGGCCTTTCCCGAAAATGTTGGTGTAGTACAAAGCACTGCAGCCCTTTTACACCCCCTACGAAGTGCGCATAACATTTCGGATGGCG
ATTT
GTATGTTATCAGTTCACTTGCTATCTCATTTCTGGTTATTCGTTGAAAATTCTTTAGGCTTCACTTCGCTGCCGCGGTTGCAATATCTAGCTGCTCCGGCGCGCCAAGGATGCGCT
TTTTGTTAGGCAGGCCTCCAGCAAAGGCACCAGCACGTAATGGACATATGATACCAAAAGCCACAGGCAA
GTTTGGAGATTCCTTCACGCGGATTAACCGACCTTCTTTCTTCTTCAGAC
AGTGTAAAGTCGGTTCTCCAACGATTTGAGGCTGCCGGAATCTCTGCCTCCGCAGTGGTGGCTCTTCTCGCCGCTCACTCGACTGCACGAAATTATGTAACGGATCCAAGTGTTATCGGG
TAAGTCCAAAAAAACACAAACCAACGAGTTTATCCCCAATGATGATTGATATTTAGCGCCCCTTTGGATTCAACCCCTCGTGTATTTGACACGCAAATATTTATTGAGACACTGCTAAAA
GGCACGAGGTTGGCTGG
GTCAGTATTTTACATAAATGTGATAATAGGAGTAGTAATTGACATCGAATGCGTAGAACCGAAGGTTCGGATAGAGAGGCCGAATCTGCCCTGCAAGGGGAGC
TGCGACTTCGATCCGATGAGCAACTCGCTCGAGATCCAGCGACGTCATGTTTTTGGCAGGCTCTCGCAGCGGACCAAACGCTGATGGAAAATCAATTCCAGTCCGCCATGCTTCAACTTC
AACTACTTGGGCAGGATACTACTACTATGATCGAGTGCAGTGAAGTGGTACCCATACCACCGCCCCCACCGTCGCAGCCGCATTTTCCGGCTGGATTCAGTAAATTCGATATAGACCAGG
CG
GTAAGCTGTGTTGTTTCGTTCATTGCTCGTATTTCTCTATTTAGACGGATTCTTTCAGTGCGCAACGGAAACCTTCCCAAGCATTCCTAGCCTCGCGGGGCCGAGGGAAACGGTAAAT
CTACAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCCGGATTTATTTTGTGCTCAATTTTGCTTCTTGGAGGCTTGCAACAGATCGGAGCTGATGTCGTTCCTTTCACCTGCAGTGATGGAAATACCGTGAAGAATAAAGAATGTTGT
CAACTTTTCCCAGTCCTGGCCGACCTTCGAGCTCTGTTTCGAGACGACCTCTGTTCTCCTGGG
GGGCATGGATTGCTTCATCTTGCGTTCCACGACGCGATCCAATTCTCTAAATCTGAT
CCGAAAGTTGGAGGAGGTGCAGATGGGTCCATTCTGACATTCAGCAACATCGAAGGGGCCTTTCCCGAAAATGTTGGTGTAGTACAAAGCACTGCAGCCCTTTTACACCCCCTACGAAGT
GCGCATAACATTTCGGATGGCGATTT
GCTTCACTTCGCTGCCGCGGTTGCAATATCTAGCTGCTCCGGCGCGCCAAGGATGCGCTTTTTGTTAGGCAGGCCTCCAGCAAAGGCACCAGCA
CGTAATGGACATATGATACCAAAAGCCACAGGCAA
TGTAAAGTCGGTTCTCCAACGATTTGAGGCTGCCGGAATCTCTGCCTCCGCAGTGGTGGCTCTTCTCGCCGCTCACTCGACTGCA
CGAAATTATGTAACGGATCCAAGTGTTATCGG
CGCCCCTTTGGATTCAACCCCTCGTGTATTTGACACGCAAATATTTATTGAGACACTGCTAAAAGGCACGAGGTTGGCTGGAACCGAA
GGTTCGGATAGAGAGGCCGAATCTGCCCTGCAAGGGGAGCTGCGACTTCGATCCGATGAGCAACTCGCTCGAGATCCAGCGACGTCATGTTTTTGGCAGGCTCTCGCAGCGGACCAAACG
CTGATGGAAAATCAATTCCAGTCCGCCATGCTTCAACTTCAACTACTTGGGCAGGATACTACTACTATGATCGAGTGCAGTGAAGTGGTACCCATACCACCGCCCCCACCGTCGCAGCCG
CATTTTCCGGCTGGATTCAGTAAATTCGATATAGACCAGGCG
TGCGCAACGGAAACCTTCCCAAGCATTCCTAGCCTCGCGGGGCCGAGGGAAACGGTAAATCTACAGTAA

Retrieve as FASTA