Entry information : TharCcP01
Entry ID 11965
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-06-24 (Catherine Mathe (Scipio))
Peroxidase information: TharCcP01
Name TharCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma harzianum    [TaxId: 5544 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TharCcP01
start..stop
S start..stop
TatCcP01 634 0 1..354 1..354
TaspCcP01 632 0 1..354 1..354
TviCcP01 626 0 1..353 1..352
HjCcP01 621 0 1..354 1..355
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1023377..1023848 472 N° 2 1022717..1023309 593  
complement(join(1022717..1023309,1023377..1023848))


exon

Literature and cross-references TharCcP01
DNA ref. JGI genome:   scaffold_3 (1023848..1022717)
Cluster/Prediction ref. JGI gene:   479191
Protein sequence: TharCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355
PWM (Da):   %s   39416.56 Transmb domain:   %s   i44-66o
PI (pH):   %s   8.77
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSARQFARVATRTTTRTFAAAPRQAFRQQGRRFYSSEPEKKSSSSLLYLGAAAAAGGLGIWFFTSGASASSKTFVPTQADYQKVYNDIAERLDADYDDGSYGPVLVRLAWHCSGTYDKETKTGGSNGATMRFAPESNHGANAGLIAARDFLEPIKAKYPWITYSDLWILGGVCAIQEMHGPIVPYRPGRRDGEAAACTPDGRLPDASQGAKHLRDIFYRMGFDDREIVALSGGHAIGRCHSNRSGYEGPWTFSPTMLTNDFYKLLLEEKWQYKKWDGPKQLEDKTTKTLMMLPTDHVLTTDKAFRPWVEKYAADNDLFFKDFSAVVLRLFELGVPFAEGSENSRWTFKPTHA*

Retrieve as FASTA  
Remarks complete sequence from genomics (1 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTTCTGCCCGTCAGTTTGCCCGCGTGGCAACCCGCACAACCACCCGCACCTTCGCTGCCGCCCCTCGACAGGCTTTCCGCCAGCAGGGCCGCCGCTTCTACTCTTCTGAGCCC
GAGAAGAAGTCATCCTCCTCTCTCCTGTACCTTGGTGCTGCCGCCGCCGCCGGTGGTCTCGGTATCTGGTTCTTCACCTCTGGTGCCTCTGCCTCCTCCAAGACCTTTGTTCCCACCCAG
GCCGATTACCAGAAGGTCTACAACGACATCGCCGAGCGTCTCGATGCCGATTATGACGATGGCAGCTACGGCCCCGTCCTGGTCCGTCTTGCATGGCACTGCAGCGGTACCTACGACAAG
GAGACCAAGACTGGTGGCAGTAACGGTGCTACCATGCGATTCGCTCCCGAGAGCAACCACGGTGCCAACGCCGGTCTGATTGCTGCTCGCGACTTCCTCGAGCCTATCAAGG
GTGAGTAG
TCTCTCCATCATTTGCGCAACATTGGGTGTCGAGTCGAGTGCTAACAATCAGCCTGTAGCCAAGTACCCCTGGATCACCTACTCTGATCTCTGGATCCTCGGCGGTGTCTGCGCCATCCA
GGAGATGCACGGCCCCATTGTCCCTTACCGACCTGGCCGCCGTGACGGTGAGGCTGCTGCTTGCACCCCCGATGGCCGTCTCCCCGACGCCAGCCAGGGCGCCAAGCACCTGCGTGACAT
CTTCTACCGCATGGGCTTCGACGACCGCGAGATTGTCGCCCTCAGCGGTGGCCACGCCATTGGCCGATGCCACTCCAACCGATCTGGCTATGAGGGTCCTTGGACCTTCTCTCCCACCAT
GCTGACCAACGACTTCTACAAGCTCCTGCTGGAGGAGAAGTGGCAGTACAAGAAGTGGGACGGTCCCAAGCAGCTCGAGGACAAGACCACCAAGACCCTGATGATGCTCCCCACCGACCA
CGTCCTGACCACTGACAAGGCCTTCCGACCTTGGGTTGAGAAGTACGCTGCCGACAACGACCTGTTCTTCAAGGACTTCTCCGCCGTCGTTCTCCGCCTCTTCGAGCTCGGTGTTCCCTT
TGCTGAGGGCAGCGAGAACAGCCGATGGACCTTCAAGCCCACCCACGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTTCTGCCCGTCAGTTTGCCCGCGTGGCAACCCGCACAACCACCCGCACCTTCGCTGCCGCCCCTCGACAGGCTTTCCGCCAGCAGGGCCGCCGCTTCTACTCTTCTGAGCCC
GAGAAGAAGTCATCCTCCTCTCTCCTGTACCTTGGTGCTGCCGCCGCCGCCGGTGGTCTCGGTATCTGGTTCTTCACCTCTGGTGCCTCTGCCTCCTCCAAGACCTTTGTTCCCACCCAG
GCCGATTACCAGAAGGTCTACAACGACATCGCCGAGCGTCTCGATGCCGATTATGACGATGGCAGCTACGGCCCCGTCCTGGTCCGTCTTGCATGGCACTGCAGCGGTACCTACGACAAG
GAGACCAAGACTGGTGGCAGTAACGGTGCTACCATGCGATTCGCTCCCGAGAGCAACCACGGTGCCAACGCCGGTCTGATTGCTGCTCGCGACTTCCTCGAGCCTATCAAGG
CCAAGTAC
CCCTGGATCACCTACTCTGATCTCTGGATCCTCGGCGGTGTCTGCGCCATCCAGGAGATGCACGGCCCCATTGTCCCTTACCGACCTGGCCGCCGTGACGGTGAGGCTGCTGCTTGCACC
CCCGATGGCCGTCTCCCCGACGCCAGCCAGGGCGCCAAGCACCTGCGTGACATCTTCTACCGCATGGGCTTCGACGACCGCGAGATTGTCGCCCTCAGCGGTGGCCACGCCATTGGCCGA
TGCCACTCCAACCGATCTGGCTATGAGGGTCCTTGGACCTTCTCTCCCACCATGCTGACCAACGACTTCTACAAGCTCCTGCTGGAGGAGAAGTGGCAGTACAAGAAGTGGGACGGTCCC
AAGCAGCTCGAGGACAAGACCACCAAGACCCTGATGATGCTCCCCACCGACCACGTCCTGACCACTGACAAGGCCTTCCGACCTTGGGTTGAGAAGTACGCTGCCGACAACGACCTGTTC
TTCAAGGACTTCTCCGCCGTCGTTCTCCGCCTCTTCGAGCTCGGTGTTCCCTTTGCTGAGGGCAGCGAGAACAGCCGATGGACCTTCAAGCCCACCCACGCTTAA

Retrieve as FASTA