Entry information : TaurCcP01
Entry ID 12012
Creation 2013-05-29 (Nizar Fawal)
Last sequence changes 2013-05-29 (Nizar Fawal)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-08-22 (Catherine Mathe (Scipio))
Peroxidase information: TaurCcP01
Name TaurCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Thermoascus
Organism Thermoascus aurantiacus    [TaxId: 5087 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TaurCcP01
start..stop
S start..stop
TstCcP02 640 0 1..365 1..359
AderCcP02 612 0 1..366 1..375
PmCcP02 610 0 1..365 1..359
CposCcP01 582 0 1..365 1..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1313621..1314140 520 N° 2 1313209..1313564 356 N° 3 1312920..1313144 225  
complement(join(1312920..1313144,1313209..1313564,1313621..1314140))


exon

Literature and cross-references TaurCcP01
DNA ref. JGI genome:   scaffold_10 (1314140..1312920)
Cluster/Prediction ref. JGI gene:   58851
Protein sequence: TaurCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   367
PWM (Da):   %s   40476.26 Transmb domain:   %s   i58-80o
PI (pH):   %s   9.32
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASAARTFSRAFARTTPATSSFRPVARNARFALPAQTLRASSRRGYASEAGSGKSSNALIWGIGLAAAGGVGAYFYLNGADVSTKSSGPFVPTKEDYQKVYDEIARLLAEKTDYDDGSYGPVLVRLAWHASGTYDKETGTGGSNGATMRFAPEASHGANAGLHVAREFLEPVKAKFPWISYSDLWTLAGVCAIQEMQGPAIPWRPGRQDKDVSACTPDGRLPDASKDQKHIRAIFGRMGFDDREMVALIGAHSLGRAHTDRSGYDGPWDFSPTVFSNEFFRLLVEEKWSWRKWNGPAQYTDNSTKTLMMLPTDIALIKDKEFRKHVERYAKDSDAFFKEFSEAFVKLLELGVPFKQEERWVFKTSA*

Retrieve as FASTA  
Remarks complete sequence from genomics (2 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCGGCTGCACGCACCTTCTCCCGGGCCTTTGCCCGCACGACCCCCGCCACCTCCTCCTTCAGACCCGTTGCTCGCAACGCCCGCTTTGCCCTGCCTGCCCAGACCCTCCGTGCC
TCGTCGCGCCGGGGATATGCCTCTGAGGCCGGCTCGGGCAAGTCTTCCAACGCCCTGATCTGGGGTATTGGTCTCGCTGCCGCCGGTGGTGTTGGCGCCTACTTCTACCTCAACGGCGCT
GACGTCTCCACCAAGTCCAGCGGCCCCTTCGTTCCCACCAAGGAGGACTACCAGAAGGTCTACGACGAGATTGCGAGACTTCTGGCTGAGAAGACCGATTACGACGATGGCAGCTATGGC
CCGGTCCTTGTTCGACTTGCGTGGCACGCGAGCGGTACCTACGACAAGGAGACTGGCACGGGTGGTAGCAACGGCGCCACCATGAGATTCGCTCCCGAGGCTTCGCACGGTGCCAACGCC
GGTCTGCACGTGGCCAGGGAGTTCCTTGAGCCTGTCAAGG
GTACGTTCCTCTTCTGTTCGTTTGCTTTGCGCGGTCAGCACTAACACAGTTCACAGCGAAGTTCCCATGGATCTCTTACT
CTGACCTCTGGACCCTGGCTGGTGTCTGCGCCATCCAGGAGATGCAGGGTCCTGCCATCCCATGGAGACCTGGCCGTCAGGACAAGGATGTCTCTGCCTGCACTCCTGACGGGCGTCTTC
CTGATGCCTCCAAGGACCAGAAGCACATCCGTGCTATTTTCGGACGCATGGGCTTCGATGACCGCGAGATGGTCGCCCTCATCGGTGCCCACTCTCTGGGCCGAGCCCACACTGACCGCT
CTGGCTATGACGGCCCTTGGGACTTCAGCCCTACTGTCTTCTCCAACGAGTTCTTCAGACTGCTGGTTGAGGAGAAGTGGTCGTGGAGGAAG
GTGAGTGCCACACGTCTTTCCATCGTCC
TAAATCTGAATGAGTAAATGCTAACATTGGCAACAGTGGAACGGTCCTGCCCAGTACACCGACAACTCCACCAAGACCCTGATGATGCTCCCGACCGACATTGCTCTCATCAAGGACAAG
GAGTTCAGGAAGCACGTCGAGCGCTATGCCAAGGACAGCGACGCGTTCTTCAAGGAATTCTCTGAGGCATTTGTCAAGCTGCTCGAGCTGGGCGTTCCGTTCAAGCAGGAAGAGAGATGG
GTCTTCAAGACCTCTGCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCGGCTGCACGCACCTTCTCCCGGGCCTTTGCCCGCACGACCCCCGCCACCTCCTCCTTCAGACCCGTTGCTCGCAACGCCCGCTTTGCCCTGCCTGCCCAGACCCTCCGTGCC
TCGTCGCGCCGGGGATATGCCTCTGAGGCCGGCTCGGGCAAGTCTTCCAACGCCCTGATCTGGGGTATTGGTCTCGCTGCCGCCGGTGGTGTTGGCGCCTACTTCTACCTCAACGGCGCT
GACGTCTCCACCAAGTCCAGCGGCCCCTTCGTTCCCACCAAGGAGGACTACCAGAAGGTCTACGACGAGATTGCGAGACTTCTGGCTGAGAAGACCGATTACGACGATGGCAGCTATGGC
CCGGTCCTTGTTCGACTTGCGTGGCACGCGAGCGGTACCTACGACAAGGAGACTGGCACGGGTGGTAGCAACGGCGCCACCATGAGATTCGCTCCCGAGGCTTCGCACGGTGCCAACGCC
GGTCTGCACGTGGCCAGGGAGTTCCTTGAGCCTGTCAAGG
CGAAGTTCCCATGGATCTCTTACTCTGACCTCTGGACCCTGGCTGGTGTCTGCGCCATCCAGGAGATGCAGGGTCCTGCC
ATCCCATGGAGACCTGGCCGTCAGGACAAGGATGTCTCTGCCTGCACTCCTGACGGGCGTCTTCCTGATGCCTCCAAGGACCAGAAGCACATCCGTGCTATTTTCGGACGCATGGGCTTC
GATGACCGCGAGATGGTCGCCCTCATCGGTGCCCACTCTCTGGGCCGAGCCCACACTGACCGCTCTGGCTATGACGGCCCTTGGGACTTCAGCCCTACTGTCTTCTCCAACGAGTTCTTC
AGACTGCTGGTTGAGGAGAAGTGGTCGTGGAGGAAG
TGGAACGGTCCTGCCCAGTACACCGACAACTCCACCAAGACCCTGATGATGCTCCCGACCGACATTGCTCTCATCAAGGACAAG
GAGTTCAGGAAGCACGTCGAGCGCTATGCCAAGGACAGCGACGCGTTCTTCAAGGAATTCTCTGAGGCATTTGTCAAGCTGCTCGAGCTGGGCGTTCCGTTCAAGCAGGAAGAGAGATGG
GTCTTCAAGACCTCTGCGTAA

Retrieve as FASTA