Entry information : LuKat(Lus10030745|PACid:23155419)
Entry ID 12056
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuKat(Lus10030745|PACid:23155419)
Name LuKat(Lus10030745|PACid:23155419)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuKat
start..stop
S start..stop
LuKat71 991 0 1..492 1..492
GhKat01 986 0 1..492 1..492
PtKat01 980 0 1..492 1..492
PdelKat01 979 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 362065..362079 15 N° 2 361760..361856 97 N° 3 361044..361321 278 N° 4 360042..360818 777
N° 5 359829..359918 90 N° 6 359641..359708 68 N° 7 359463..359556 94 N° 8 359302..359361 60
complement(join(359302..359361,359463..359556,359641..359708,359829..359918,3600 42..360818,361044..361321,361760..361856,362065..362079))


exon

Literature and cross-references LuKat(Lus10030745|PACid:23155419)
DNA ref. Phytozome 12:   scaffold373 (362079..359302)
Protein sequence: LuKat(Lus10030745|PACid:23155419)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   493
PWM (Da):   %s   56774.17  
PI (pH):   %s   7.25
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKHRPSSAFNSPFWTTNSGAPVWNNNSSMTVGPRGPILLEDYHLVEKLANFDRERIPERVVHARGASAKGFFEVTHDISNLTCADFLRAPGVQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTREGNWDLVGNNFPVFFVRDGMKFPDMVHALKPNPKSHIQENWRILDFFSHHPESLHMFSFLFDDLGVPQDYRHMEGSGVNTYTLVSKSGKAHLVKFHWKPTCGVKCLLENEAIKVGGANHSHATQDLYDSIAAGNYPEWKLFIQTIDPDHEDRFDFDPLDVTKTWPEDIIPLQPVGRLVLNKNIDNFFAENEQLAFCPAIVVPGVYYSDDKLLQTRIFSYSDTQRHRLGPNYLQLPVNAPKCAHHNNHHEGFMNFMHRDEEVNYFPSRYDPVRNSEQFPIPPQVCTGRREKCVISKENNFKQPGERYRSWAPDRQERFICRWIDALSDPRVTHEIRSIWISYWSQADQSLGQKLASRMNVKPSI*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGGTACGTACTCTGTGTTTCTTTGATTGTTTCGTTGATTCCTTGGTGGGTTCGGTTGATCTGAACCCTAGGCCCTGATTTAGCTTCAGGGGTTTACTCGGATGTTTT
CGGTTCTTCATGTCATGATTTGGCTTGTTGTTATTTTGATCATCTCTTCTTTTTGTAATTAGATTACTGATGGGTGGATTGCCCGTTGGTTTTTGATTTGCAGCATCGTCCTTCGAGCGC
TTTCAATTCTCCTTTCTGGACTACCAATTCTGGAGCTCCAGTATGGAACAACAACTCTTCCATGACCGTTGGCCCTAGAG
GTATTGTTTCCCCCCTCTGTTCTTTTTGGCTGTGATCTTT
CATTTTTTTGGTGGGGTGTTGAATTGTTACAAACTTTTTTATGATTCTAGTAGTCTTTGATAGAGAAGTGTTCTTTTTTTATGAATTTTGATAGAGAAGTGTTGGTGCGTCTTTGATTTT
TAGAATGATATACACTTAATCTCTTGTTCTGCTACCCGTGTCTGTGTTTTGATGTATAATGATTTAATAGTATGGTTAGCTTCTTGCTTCCCGTTTGTGATTCTATTTGTTGAACTCGCG
GACCTCTTCAGAACACAAAATACAAGTTGAGGTTGAGATTTACAGGCATTGAGACGGTGGACGATCATAGTATGAACATAGTCTAGGTGTCGATTATGAATGCCGGAGATTTGAAATGCA
TTTGTGGCCTACCATAATACGTGTTTCTGTTTTGACAGGTCCAATTCTGCTAGAGGATTATCATTTGGTGGAGAAACTGGCCAACTTTGATAGGGAACGTATTCCAGAGCGTGTTGTCCA
TGCTAGGGGAGCAAGTGCAAAGGGTTTCTTTGAAGTCACCCATGATATCTCTAATCTCACATGTGCTGATTTCCTCCGAGCTCCTGGTGTCCAGACACCTGTTATTGTTCGATTCTCTAC
CGTTATCCATGAACGTGGCAGTCCTGAAACTCTGAGAGATCCTAGGGGTTTTGCAGTGAAGTTCTACACTAGAGAG
GTAAACAGTTCATTTTTGTATAAATAAATTTACAGAACTACAGT
CCATTACATATGGAATAATCACTTGTATTTTTCGACAAAGCCTGGTGGATGTATTTTGGTAATTCCTGAATAATAAGGCTGGATGGATATATATGTACCTTAGATTATGCAGCTGACCAT
TTAAGTACTCCAAGGTTCAGTTTTGGGAGGGAGTTCTTACTATCACTTGCTCTTCATGCAGGGGAACTGGGATCTTGTCGGTAACAATTTCCCAGTTTTCTTTGTCCGTGATGGAATGAA
GTTCCCTGATATGGTACATGCCCTCAAGCCAAACCCGAAATCTCACATTCAGGAGAACTGGAGAATCCTCGATTTCTTCTCACATCACCCTGAAAGTTTGCATATGTTCTCCTTCCTCTT
TGACGATCTCGGTGTTCCTCAAGATTACAGGCACATGGAGGGTTCAGGTGTTAACACCTATACATTGGTGAGCAAGTCTGGCAAAGCTCACCTTGTCAAGTTTCACTGGAAACCCACTTG
TGGTGTCAAGTGTCTATTGGAGAATGAGGCAATTAAGGTTGGTGGAGCAAATCATAGCCATGCTACTCAAGATCTGTATGATTCAATTGCTGCTGGAAACTACCCAGAATGGAAGCTTTT
CATCCAGACAATTGATCCAGATCACGAGGATAGATTTGATTTTGACCCACTTGACGTGACCAAGACCTGGCCTGAAGATATCATTCCTCTACAGCCGGTTGGCCGCTTGGTCTTGAACAA
GAACATCGATAACTTCTTTGCGGAAAACGAGCAGCTTGCTTTCTGCCCTGCAATCGTGGTTCCTGGTGTTTATTATTCAGATGACAAGCTTCTTCAGACTCGTATCTTCTCCTATTCCGA
CACTCAGAGGCACCGACTTGGACCAAACTATTTGCAGCTCCCTGTTAATGCTCCAAAGTGTGCTCATCACAACAATCACCATGAAGGTTTCATGAACTTCATGCACAGGGATGAAGAG
GT
ATTAGACTCCACACTAATCTCTACTTTTTTCGTATTGAGTAGATCAACGAAAGCAACAACTATATATCCTCCTTGTTTTCTGATCATGATCTGATCTGTCTTTGATGTTGCAACATTTCA
GGTAAACTACTTCCCATCAAGGTACGATCCAGTTCGCAACTCTGAGCAATTCCCCATTCCTCCTCAAGTCTGCACTGGAAGGCGTGAGAAGGTCAGCCCGTTAAAGTGTTCCACTTTCTG
ATGGAAACCGTTGTCTAGCTCATCAATCACCTATCTTGTTGGTAATACTATCAACTTGTTGCTGACTTACTTACCTTTCCTGTTAATCCAGTGCGTGATTTCCAAAGAGAACAACTTCAA
GCAACCTGGGGAGAGATACCGCTCATGGGCACCTGACAG
GTAAGCCATAAAACTCCAGTTATTGCAGACAGAAGCGATATCAGTTTCTTTCAACAGCAAGTTAACACTTTCTTTTTCATC
CAGGCAAGAAAGATTCATCTGCCGATGGATCGATGCCCTTTCCGATCCTCGTGTCACCCACGAAATCCGCAGCATCTGGATCTCATACTGGTCACAGGTTTGAAAACCCCCTTTGTGTTT
CTGTCAACAACATTGTAGTGAAACTGGCCCTTACGTGTATTCTGACTGCATGAATATTTGCTGGGTTTGGTTTTGCAGGCTGACCAATCTCTCGGACAGAAGTTAGCAAGCCGTATGAAC
GTGAAGCCAAGCATTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGCATCGTCCTTCGAGCGCTTTCAATTCTCCTTTCTGGACTACCAATTCTGGAGCTCCAGTATGGAACAACAACTCTTCCATGACCGTTGGCCCTAGAGGTCCAATT
CTGCTAGAGGATTATCATTTGGTGGAGAAACTGGCCAACTTTGATAGGGAACGTATTCCAGAGCGTGTTGTCCATGCTAGGGGAGCAAGTGCAAAGGGTTTCTTTGAAGTCACCCATGAT
ATCTCTAATCTCACATGTGCTGATTTCCTCCGAGCTCCTGGTGTCCAGACACCTGTTATTGTTCGATTCTCTACCGTTATCCATGAACGTGGCAGTCCTGAAACTCTGAGAGATCCTAGG
GGTTTTGCAGTGAAGTTCTACACTAGAGAG
GGGAACTGGGATCTTGTCGGTAACAATTTCCCAGTTTTCTTTGTCCGTGATGGAATGAAGTTCCCTGATATGGTACATGCCCTCAAGCCA
AACCCGAAATCTCACATTCAGGAGAACTGGAGAATCCTCGATTTCTTCTCACATCACCCTGAAAGTTTGCATATGTTCTCCTTCCTCTTTGACGATCTCGGTGTTCCTCAAGATTACAGG
CACATGGAGGGTTCAGGTGTTAACACCTATACATTGGTGAGCAAGTCTGGCAAAGCTCACCTTGTCAAGTTTCACTGGAAACCCACTTGTGGTGTCAAGTGTCTATTGGAGAATGAGGCA
ATTAAGGTTGGTGGAGCAAATCATAGCCATGCTACTCAAGATCTGTATGATTCAATTGCTGCTGGAAACTACCCAGAATGGAAGCTTTTCATCCAGACAATTGATCCAGATCACGAGGAT
AGATTTGATTTTGACCCACTTGACGTGACCAAGACCTGGCCTGAAGATATCATTCCTCTACAGCCGGTTGGCCGCTTGGTCTTGAACAAGAACATCGATAACTTCTTTGCGGAAAACGAG
CAGCTTGCTTTCTGCCCTGCAATCGTGGTTCCTGGTGTTTATTATTCAGATGACAAGCTTCTTCAGACTCGTATCTTCTCCTATTCCGACACTCAGAGGCACCGACTTGGACCAAACTAT
TTGCAGCTCCCTGTTAATGCTCCAAAGTGTGCTCATCACAACAATCACCATGAAGGTTTCATGAACTTCATGCACAGGGATGAAGAG
GTAAACTACTTCCCATCAAGGTACGATCCAGTT
CGCAACTCTGAGCAATTCCCCATTCCTCCTCAAGTCTGCACTGGAAGGCGTGAGAAG
TGCGTGATTTCCAAAGAGAACAACTTCAAGCAACCTGGGGAGAGATACCGCTCATGGGCACCT
GACAG
GCAAGAAAGATTCATCTGCCGATGGATCGATGCCCTTTCCGATCCTCGTGTCACCCACGAAATCCGCAGCATCTGGATCTCATACTGGTCACAGGCTGACCAATCTCTCGGACAG
AAGTTAGCAAGCCGTATGAACGTGAAGCCAAGCATTTGA

Retrieve as FASTA