Entry information : LuPrx07(Lus10000346|PACid:23156071)
Entry ID 12062
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx07(Lus10000346|PACid:23156071)
Name LuPrx07(Lus10000346|PACid:23156071)
Class Class III peroxidase    [Orthogroup: Prx034]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx07
start..stop
S start..stop
LuPrx31 619 0 1..316 1..316
EcamPrx191 459 5e-163 10..316 7..311
EguPrx191 458 8e-163 10..316 7..311
PpePrx28 457 2e-162 1..316 1..312
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2062..2283 222 N° 2 1757..1948 192 N° 3 1147..1678 532 N° 4 82..335 254
complement(join(82..335,1147..1678,1757..1948,2062..2283))


exon

Literature and cross-references LuPrx07(Lus10000346|PACid:23156071)
DNA ref. Phytozome 12:   scaffold1041 (2283..82)
Protein sequence: LuPrx07(Lus10000346|PACid:23156071)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   400 (372)
PWM (Da):   %s   43125.75 (40210.2)  
PI (pH):   %s   8.92 (8.75) Peptide Signal:   %s   cut: 28 range:28-399
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYSSVKSLFVTLFIIGSSVLVSTSNAQLAGNFYARTCPNVQGIVNRVMREAVNREPRLGASILRLFFHDCFVNGCDGSILLDDTSSFTGEKNANPNRNSVRGFEVIDTIKTRVESACNATVSCADLLAIAARDGVVLLGGPSWQVLLGRRDARTASQSDANNDLPSPFSDLPALISSFTNKGLTAADMTVLSGGHTIGQARCTTFRNRIYNETNIGPNFAANRRANCPSTAGTGDGNLAPLDLSPNRFDNAYYRELVGQRGLLHSDQQLFSGGSQDALVRTYSTNVNAFARDFANAMIRMGSLSPLTGSNGEIRRFVNGKFCKDPMQANADDISFNGLNVPRNTSSNKMGSNVIFLNIDKIPRLNTLGISLARLHYAPHRGLNPPHTHTRDTEILVVI*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTATTCCTCTGTCAAGTCCTTGTTTGTAACCCTCTTCATTATTGGGTCGTCTGTGCTAGTTTCAACCAGTAACGCCCAACTCGCTGGGAACTTCTACGCTCGAACATGCCCTAAC
GTTCAGGGCATAGTTAATCGTGTAATGAGGGAAGCTGTTAATAGAGAGCCCCGTCTCGGTGCATCTATCCTTCGCTTGTTCTTTCACGATTGTTTCGTCAAT
GTAAGTTTTCATAAAACA
ATATTAGATTGACCATTGAGTTGAATACCTTCTTGTGCATACAATGTTTGTCACCAAATTTCTAATGTTCACAAGGTTACTTCTTTTTTTGCTAGGGATGTGACGGGTCTATTTTGCTAG
ACGATACGTCCTCATTTACAGGGGAGAAGAATGCGAATCCTAATCGGAACTCAGTTCGAGGGTTTGAGGTCATTGACACCATCAAAACCAGAGTTGAAAGTGCTTGCAATGCTACTGTTT
CTTGTGCAGATCTACTTGCAATTGCTGCTAGGGACGGTGTCGTATTG
GTAATTCTCTTTTCTTCGCTTGCTCATTAAGATCTACCAATTTTCCAACGTAACTATCTGATCAAATTTTGCA
TGCAGCTTGGTGGGCCATCGTGGCAAGTCCTACTGGGCCGGAGGGACGCAAGAACAGCCAGCCAAAGCGACGCCAACAATGACCTCCCCTCCCCATTCTCCGACCTTCCAGCCCTAATCT
CATCCTTTACCAACAAGGGCCTAACCGCCGCCGACATGACCGTCCTCTCCGGCGGCCACACCATCGGCCAAGCCAGGTGCACCACTTTCCGCAACCGAATCTACAACGAGACCAACATCG
GGCCTAACTTTGCCGCCAACAGAAGGGCCAACTGCCCCTCTACTGCCGGCACGGGCGACGGGAACTTGGCCCCACTCGACTTGTCTCCGAACAGATTCGACAATGCTTATTACAGGGAGC
TTGTGGGCCAACGTGGGCTACTTCATTCCGACCAACAGCTGTTCAGCGGTGGGTCCCAGGATGCTTTGGTCAGGACTTATAGTACGAATGTCAATGCGTTTGCTAGGGATTTTGCAAATG
CCATGATTAGGATGGGGAGCCTTAGTCCTCTCACTGGGAGTAATGGCGAGATTAGGC
GTAATTGCAGGATTATAAATTAATTATTTAGAGTACGTAAGGTTTCCAAACATTTATGTTTGG
ACGTGTTGTACTACTACTGTGCTCGTGGAGTATTTTAAGAGGTATTGGGTTTCCATACATGCGTCACGTCCATAAATGAATACTTATAAAATGTTGTTTTTTTCTTCGAAAAAATTATTT
ACTTCTTGATAAATTTGTATGTTTATTGGTCGACTCTCAACTTTTTATCAAAAAATAAAAATGATCATCGTCATAGTTGACTTCTATCTTCAGTCACTTAACTCATTATAATAGAACTAG
TTTAACGAGCAAATATCAAACCAAATGATGATCATCAATCTAATTAACAACTTATTACATATAATTACATTAGATCATTGAAACGGTCGAATGATGATCATTTGTGTAATTAGCTAATGA
ATGGCAGAGGTTTAAGAAACTTCTGGGAAAGGGATGGGTGTGGACTTTCCGCGGAAATGATTACTCTACATAATAATATTGAGCTAGTACACAAATAAGATTAATAACTATTATTTTAAT
ACAAAAGATTGCAGCAATAAATAAATAAATAAATATATATATATAGTAACCGATGAAGATCTCTACATAATTAATAAGATCAATAACTATTTTAATACAAATTAAGAATTCTGACACCTC
TGTCCCTATAATTGTAAATACATGTAGCCTACGCTTCCCAGTTCATCATCCACGACCACAACAACAAGGCAATAACACAAAAACATATTAGTTACAATTAGATCCATTCAAAAGAACTCC
CTCACAATTGATGATCCTAAACATGGAGGGTTTGTGAATGGCAAGTTCTGCAAGGATCCCATGCAGGCTAATGCGGATGACATCTCCTTCAATGGACTCAACGTCCCCAGAAACACATCC
TCCAACAAAATGGGTTCGAACGTCATTTTTCTCAATATCGACAAGATTCCAAGGCTCAACACCTTAGGAATCTCCTTAGCTCGTCTCCACTACGCTCCCCACAGAGGGCTCAACCCACCC
CACACCCACACTCGTGACACTGAGATTTTGGTTGTCATTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTATTCCTCTGTCAAGTCCTTGTTTGTAACCCTCTTCATTATTGGGTCGTCTGTGCTAGTTTCAACCAGTAACGCCCAACTCGCTGGGAACTTCTACGCTCGAACATGCCCTAAC
GTTCAGGGCATAGTTAATCGTGTAATGAGGGAAGCTGTTAATAGAGAGCCCCGTCTCGGTGCATCTATCCTTCGCTTGTTCTTTCACGATTGTTTCGTCAAT
GGATGTGACGGGTCTATT
TTGCTAGACGATACGTCCTCATTTACAGGGGAGAAGAATGCGAATCCTAATCGGAACTCAGTTCGAGGGTTTGAGGTCATTGACACCATCAAAACCAGAGTTGAAAGTGCTTGCAATGCT
ACTGTTTCTTGTGCAGATCTACTTGCAATTGCTGCTAGGGACGGTGTCGTATTG
CTTGGTGGGCCATCGTGGCAAGTCCTACTGGGCCGGAGGGACGCAAGAACAGCCAGCCAAAGCGAC
GCCAACAATGACCTCCCCTCCCCATTCTCCGACCTTCCAGCCCTAATCTCATCCTTTACCAACAAGGGCCTAACCGCCGCCGACATGACCGTCCTCTCCGGCGGCCACACCATCGGCCAA
GCCAGGTGCACCACTTTCCGCAACCGAATCTACAACGAGACCAACATCGGGCCTAACTTTGCCGCCAACAGAAGGGCCAACTGCCCCTCTACTGCCGGCACGGGCGACGGGAACTTGGCC
CCACTCGACTTGTCTCCGAACAGATTCGACAATGCTTATTACAGGGAGCTTGTGGGCCAACGTGGGCTACTTCATTCCGACCAACAGCTGTTCAGCGGTGGGTCCCAGGATGCTTTGGTC
AGGACTTATAGTACGAATGTCAATGCGTTTGCTAGGGATTTTGCAAATGCCATGATTAGGATGGGGAGCCTTAGTCCTCTCACTGGGAGTAATGGCGAGATTAGGC
GGTTTGTGAATGGC
AAGTTCTGCAAGGATCCCATGCAGGCTAATGCGGATGACATCTCCTTCAATGGACTCAACGTCCCCAGAAACACATCCTCCAACAAAATGGGTTCGAACGTCATTTTTCTCAATATCGAC
AAGATTCCAAGGCTCAACACCTTAGGAATCTCCTTAGCTCGTCTCCACTACGCTCCCCACAGAGGGCTCAACCCACCCCACACCCACACTCGTGACACTGAGATTTTGGTTGTCATTTAG

Retrieve as FASTA