Entry information : LuPrx107(Lus10020064|PACid:23156235)
Entry ID 12067
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx107(Lus10020064|PACid:23156235)
Name LuPrx107(Lus10020064|PACid:23156235)
Class Class III peroxidase     [Orthogroup: Prx011]*
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx107
start..stop
S start..stop
LuPrx33 299 2e-102 1..238 1..251
LuPrx99 236 1e-77 3..238 2..251
LuPrx39 229 5e-75 26..238 26..252
RcPrx43 219 3e-71 1..238 1..256
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 675397..675570 174 N° 2 675657..675849 193 N° 3 675992..676341 350  
join(675397..675570,675657..675849,675992..676341)


exon

Literature and cross-references LuPrx107(Lus10020064|PACid:23156235)
DNA ref. Phytozome 12:   scaffold23 (675397..676341)
Protein sequence: LuPrx107(Lus10020064|PACid:23156235)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   238 (216)
PWM (Da):   %s   26310.24 (23770.9)  
PI (pH):   %s   7.28 (6.88) Peptide Signal:   %s   cut: 23 range:23-238
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASKGLWPLLLLQICFTFTSANPRQLKVGYYARTFPNAERQSAVLCLRMYFHDCFIRGCDASVLIDSTKDRRSEKDAFANLSLGGFGVIDRVKASLEMECPGIVSCSDILAIVARDVTVAVYERATMGSGEKDIHNGRGAIRPYPTVGEYLLLDLTLQCRAFDQGLSIKDLVVLQGSHTIGISHCSSFTSRIYNFSESSDVDPTLDSEYVPNLRRKCRTATDQTKVVEMDPGSLKTF*

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction. 3' end is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTTCAAAGGGCTTGTGGCCTCTGTTACTCCTCCAAATTTGCTTCACCTTTACGTCCGCCAACCCACGACAGCTGAAAGTGGGCTACTACGCAAGAACATTCCCAAATGCTGAG
AGGCAATCGGCGGTCCTTTGCCTCAGGATGTACTTCCATGATTGCTTCATCAGG
GTAATTAGCATACAATCTATGGTGTATTGATTAGTTATCTTATATGAATAATGGTCATAGACTTCA
TTTGATTTGATCTATGGCAGGGTTGTGATGCTTCAGTTTTGATAGATTCGACAAAAGACCGCCGATCTGAAAAGGATGCCTTCGCGAATCTCAGCCTCGGAGGGTTTGGAGTCATCGACC
GAGTAAAGGCATCCCTTGAGATGGAGTGTCCAGGCATCGTCTCGTGCTCAGATATCCTAGCCATTGTAGCTAGAGATGTTACGGTCGCGGTAT
GTAATTATAACAAAAAAAACCATTCAT
AATTAAAAAACTCTACGATTTTCTAAGCATAGTTAGTAAAATAAGATACGAATAAGTTATGGTAGAAATACATACGGGTATTTTACTTCATAACAATGTGTACGTACAAATGCAGACGAA
AGGGCTACGATGGGAAGTGGAGAGAAGGATATCCATAATGGACGAGGCGCTATTCGGCCATATCCCACAGTCGGCGAATATCTCCTTCTTGACCTCACGCTTCAATGTCGGGCTTTCGAT
CAAGGACTTTCGATCAAGGACTTGGTTGTGCTACAAGGAAGCCACACCATAGGAATCTCCCATTGCTCTTCCTTCACCAGCAGAATCTACAACTTCTCAGAAAGCAGCGACGTGGACCCT
ACCCTGGACTCGGAGTATGTACCCAATCTGAGACGGAAATGTAGAACGGCGACGGATCAGACGAAGGTGGTGGAAATGGACCCCGGAAGCCTCAAGACATTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTTCAAAGGGCTTGTGGCCTCTGTTACTCCTCCAAATTTGCTTCACCTTTACGTCCGCCAACCCACGACAGCTGAAAGTGGGCTACTACGCAAGAACATTCCCAAATGCTGAG
AGGCAATCGGCGGTCCTTTGCCTCAGGATGTACTTCCATGATTGCTTCATCAGG
GGTTGTGATGCTTCAGTTTTGATAGATTCGACAAAAGACCGCCGATCTGAAAAGGATGCCTTCGCG
AATCTCAGCCTCGGAGGGTTTGGAGTCATCGACCGAGTAAAGGCATCCCTTGAGATGGAGTGTCCAGGCATCGTCTCGTGCTCAGATATCCTAGCCATTGTAGCTAGAGATGTTACGGTC
GCGGTAT
ACGAAAGGGCTACGATGGGAAGTGGAGAGAAGGATATCCATAATGGACGAGGCGCTATTCGGCCATATCCCACAGTCGGCGAATATCTCCTTCTTGACCTCACGCTTCAATGT
CGGGCTTTCGATCAAGGACTTTCGATCAAGGACTTGGTTGTGCTACAAGGAAGCCACACCATAGGAATCTCCCATTGCTCTTCCTTCACCAGCAGAATCTACAACTTCTCAGAAAGCAGC
GACGTGGACCCTACCCTGGACTCGGAGTATGTACCCAATCTGAGACGGAAATGTAGAACGGCGACGGATCAGACGAAGGTGGTGGAAATGGACCCCGGAAGCCTCAAGACATTTTGA

Retrieve as FASTA