Entry information : LuPrx11(Lus10000626|PACid:23147720)
Entry ID 12070
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx11(Lus10000626|PACid:23147720)
Name LuPrx11(Lus10000626|PACid:23147720)
Class Class III peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx11
start..stop
S start..stop
LuPrx32 194 4e-63 1..104 1..102
LuPrx31 173 3e-55 1..104 1..103
LuPrx07 174 7e-55 1..104 1..103
VvPrx20 152 4e-47 9..104 2..99
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 41985..42209 225 N° 2 41773..41880 108  
complement(join(41773..41880,41985..42209))


exon

Literature and cross-references LuPrx11(Lus10000626|PACid:23147720)
DNA ref. Phytozome 12:   scaffold542 (42209..41773)
Protein sequence: LuPrx11(Lus10000626|PACid:23147720)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   110 (82)
PWM (Da):   %s   11896.96 (8932.5) Transmb domain:   %s   o10-32i
PI (pH):   %s   8.07 (8.07) Peptide Signal:   %s   cut: 29 range:29-110
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYSFDNKSSFVTLFVIVLSVLASSSNGQLAGNFYARTCPNVQGIVRGAMREAVNREPRLGASILRLFFHDCFVNGCDGSILLDDTSTFTGEKNAIPNRNSARGTHLERL*

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction. PS.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTATTCCTTTGATAATAAGTCCTCGTTCGTAACTCTCTTCGTTATTGTACTGTCGGTCCTGGCCTCTAGCAGTAACGGCCAACTGGCTGGGAACTTCTATGCAAGAACGTGTCCT
AACGTTCAAGGCATCGTCCGGGGTGCGATGAGGGAAGCTGTTAATAGAGAGCCCCGCCTCGGTGCTTCTATCCTTCGCTTGTTCTTCCACGACTGTTTCGTCAAT
GTAAGTTGTATAAGA
TTGATCATTGAGTAACGTAACGTTCTTGTGAATATAAAAGATATGTTGTTACGAATTTCTAATCTTCGAAAGGTTATCTCTTTTATTAGGGATGCGACGGGTCTATTTTGCTCGATGACA
CGTCAACATTTACGGGGGAGAAGAACGCAATTCCGAATCGGAACTCAGCTAGAGGAACGCATCTAGAGCGTTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTATTCCTTTGATAATAAGTCCTCGTTCGTAACTCTCTTCGTTATTGTACTGTCGGTCCTGGCCTCTAGCAGTAACGGCCAACTGGCTGGGAACTTCTATGCAAGAACGTGTCCT
AACGTTCAAGGCATCGTCCGGGGTGCGATGAGGGAAGCTGTTAATAGAGAGCCCCGCCTCGGTGCTTCTATCCTTCGCTTGTTCTTCCACGACTGTTTCGTCAAT
GGATGCGACGGGTCT
ATTTTGCTCGATGACACGTCAACATTTACGGGGGAGAAGAACGCAATTCCGAATCGGAACTCAGCTAGAGGAACGCATCTAGAGCGTTTGTAA

Retrieve as FASTA