Entry information : LuPrx112(Lus10020422|PACid:23139603)
Entry ID 12073
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx112(Lus10020422|PACid:23139603)
Name LuPrx112(Lus10020422|PACid:23139603)
Class Class III peroxidase     [Orthogroup: Prx005]*
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx112
start..stop
S start..stop
LuPrx36 432 3e-154 4..278 1..323
LuPrx37 426 4e-152 4..278 1..324
LuPrx35 324 6e-113 4..278 7..245
LuPrx111 303 2e-104 4..278 7..254
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 78186..78600 415 N° 2 78710..79131 422  
join(78186..78600,78710..79131)


exon

Literature and cross-references LuPrx112(Lus10020422|PACid:23139603)
DNA ref. Phytozome 12:   scaffold44 (78186..79131)
Protein sequence: LuPrx112(Lus10020422|PACid:23139603)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   278 (254)
PWM (Da):   %s   30441.42 (27622.0)  
PI (pH):   %s   10.31 (10.18) Peptide Signal:   %s   cut: 25 range:25-278
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKMTILFVFWLVMVVANRSPVDAQGTRVGFYSTSCPRAESIVRATVQSHFNSDPTIAPGILRMHFHDCFVHGCDGSILLDGANAEKTAGANQGGETGGYHWHRTQQTCRRLMTRPQFKLANTIRKDLTLRILLLSLVRAHTIGTAACAVFRYRLYNFPGSASGADPTLDPAFVPQLRAVCPQNGNAARRVAMDTGSPNRFDNSYYANLRSGRTVLESDSVLWTDAGTRVMAQRFLGIRGLAGLTFAVEFARSMVRMGNIEIKSGAQGEIRRVCSAVN*

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction. PS is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGATGACGATATTGTTTGTGTTTTGGCTTGTAATGGTTGTAGCCAACAGGTCCCCCGTTGATGCCCAAGGGACTCGGGTAGGCTTCTATTCCACTTCATGTCCACGAGCCGAG
TCTATTGTCCGAGCAACGGTCCAGTCACATTTCAACTCCGACCCCACCATTGCCCCTGGGATATTAAGGATGCACTTTCATGACTGTTTCGTCCACGGATGCGACGGTTCCATACTTCTC
GACGGCGCCAACGCTGAGAAAACGGCCGGTGCCAATCAGGGAGGAGAGACGGGAGGGTATCACTGGCATCGGACACAACAAACTTGCCGGCGTTTAATGACTCGGCCGCAGTTCAAATTA
GCAAATACAATCAGAAAGGACTTAACACTCAGGATCTTGTTGCTCTCTCTGGTAC
GTGTTAATTAGCTGGACAATTAATAGAATTGATGAAAGAAGAAGTAATCTAATTCATCATTACCT
CATTATGAATCATCTATCTGATCTGATTATGGTTGACTAAACAGGGGCCCACACAATAGGGACGGCTGCCTGCGCGGTTTTCCGGTACAGGCTGTACAACTTTCCGGGCTCTGCTTCTGG
CGCCGACCCGACGCTCGACCCGGCTTTTGTTCCCCAACTGAGGGCCGTCTGCCCGCAAAACGGAAATGCGGCTAGGAGGGTGGCGATGGACACGGGAAGCCCTAACCGATTTGACAATTC
ATACTATGCTAATTTGAGGAGCGGCCGAACTGTTCTTGAATCGGACTCTGTTCTGTGGACAGACGCCGGGACAAGAGTGATGGCACAGAGGTTCCTCGGGATCAGAGGATTGGCCGGCTT
GACTTTCGCAGTGGAGTTCGCCAGATCAATGGTGAGGATGGGCAACATCGAAATCAAGAGCGGAGCCCAAGGTGAGATCCGGCGAGTCTGCTCCGCCGTCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGATGACGATATTGTTTGTGTTTTGGCTTGTAATGGTTGTAGCCAACAGGTCCCCCGTTGATGCCCAAGGGACTCGGGTAGGCTTCTATTCCACTTCATGTCCACGAGCCGAG
TCTATTGTCCGAGCAACGGTCCAGTCACATTTCAACTCCGACCCCACCATTGCCCCTGGGATATTAAGGATGCACTTTCATGACTGTTTCGTCCACGGATGCGACGGTTCCATACTTCTC
GACGGCGCCAACGCTGAGAAAACGGCCGGTGCCAATCAGGGAGGAGAGACGGGAGGGTATCACTGGCATCGGACACAACAAACTTGCCGGCGTTTAATGACTCGGCCGCAGTTCAAATTA
GCAAATACAATCAGAAAGGACTTAACACTCAGGATCTTGTTGCTCTCTCTGGTAC
GGGCCCACACAATAGGGACGGCTGCCTGCGCGGTTTTCCGGTACAGGCTGTACAACTTTCCGGGC
TCTGCTTCTGGCGCCGACCCGACGCTCGACCCGGCTTTTGTTCCCCAACTGAGGGCCGTCTGCCCGCAAAACGGAAATGCGGCTAGGAGGGTGGCGATGGACACGGGAAGCCCTAACCGA
TTTGACAATTCATACTATGCTAATTTGAGGAGCGGCCGAACTGTTCTTGAATCGGACTCTGTTCTGTGGACAGACGCCGGGACAAGAGTGATGGCACAGAGGTTCCTCGGGATCAGAGGA
TTGGCCGGCTTGACTTTCGCAGTGGAGTTCGCCAGATCAATGGTGAGGATGGGCAACATCGAAATCAAGAGCGGAGCCCAAGGTGAGATCCGGCGAGTCTGCTCCGCCGTCAATTGA

Retrieve as FASTA