Entry information : LuPrx114(Lus10020826|PACid:23177939)
Entry ID 12074
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx114(Lus10020826|PACid:23177939)
Name LuPrx114(Lus10020826|PACid:23177939)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx114
start..stop
S start..stop
LuPrx73 593 0 1..333 1..325
CanPrx01 451 6e-161 7..333 17..332
RcPrx54 447 2e-159 5..333 4..324
StPrx28 446 1e-158 1..333 12..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 70607..70999 393 N° 2 71074..71682 609  
join(70607..70999,71074..71682)


exon

Literature and cross-references LuPrx114(Lus10020826|PACid:23177939)
DNA ref. Phytozome 12:   scaffold711 (70607..71682)
Protein sequence: LuPrx114(Lus10020826|PACid:23177939)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (310)
PWM (Da):   %s   35202.53 (32671.2)  
PI (pH):   %s   7.36 (7.31) Peptide Signal:   %s   cut: 24 range:24-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTTSQFIVTLVLAMSALSVMVHGQGTRVGFYSTSCPRVETIVRTAVQSHFASDPTVAAGLLRMHFHDCFVQGCDASVLISGTGTERTAVPNQSLNGFSAIDDAKTQLETACPGVVSCADILALAARDSVVLTSGLSWPVPTGRRDGRVSVQQEADDNLPGPADTVDSQIRQFSTLGLNVQDLVTLSAGHTLGTASCATFSYRLYNYNNTGGPDPSIAPAFLTTLRSFCPQNGDGSRRVAMDTGSQNRFDNSYFTNIRNGRGVLESDQRVVVDPPAGRVVGGGGVVSGWRYLGLSGLLGLTFNVEFGRSMVKMSNIGVKTGTNGEIRRVCSAIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCACCTCACAATTCATAGTCACCCTTGTCCTAGCAATGTCTGCCCTATCCGTTATGGTCCATGGACAGGGAACCCGGGTCGGGTTCTACTCAACCAGCTGCCCTCGGGTCGAGACC
ATAGTCCGAACCGCGGTCCAATCCCACTTCGCCTCCGACCCTACGGTGGCTGCAGGCTTGCTCAGGATGCATTTCCACGACTGTTTCGTGCAGGGCTGCGACGCTTCCGTCCTTATCTCT
GGAACCGGTACCGAGAGAACCGCCGTCCCTAATCAGTCCCTCAACGGCTTCTCAGCCATTGATGATGCCAAGACTCAGCTCGAAACTGCTTGTCCTGGCGTCGTCTCCTGCGCTGATATC
CTCGCTCTAGCTGCTCGCGACTCCGTCGTTTTG
GTAAAGTAGTCGTTACTATCACTTGTATGTATTTGTCGTAATGTTGCTAATAATTAATTAATTAATTCGATCAGACAAGCGGACTAA
GCTGGCCAGTTCCCACGGGACGAAGAGACGGCAGAGTTTCAGTCCAACAGGAAGCTGACGACAATTTGCCAGGACCAGCGGATACCGTCGATTCGCAGATCCGGCAGTTTAGCACTCTCG
GCCTCAACGTTCAGGATCTCGTTACTCTCTCAGCTGGACACACTCTGGGGACAGCATCCTGCGCTACATTCAGCTACAGGCTCTACAACTACAACAACACGGGCGGACCCGACCCGTCGA
TCGCTCCCGCATTCCTCACCACGCTCCGGTCATTCTGCCCGCAGAACGGCGACGGATCGAGGCGGGTGGCGATGGACACCGGCAGCCAGAACCGGTTTGACAACTCGTATTTTACCAACA
TCAGGAACGGCCGTGGAGTTCTGGAGTCCGACCAGCGGGTGGTGGTGGACCCCCCGGCGGGACGCGTGGTGGGGGGGGGGGGGGTAGTGTCTGGGTGGCGGTATTTGGGCCTCAGTGGGC
TTCTTGGGCTTACTTTCAATGTTGAGTTTGGGAGGTCCATGGTGAAGATGAGTAATATTGGTGTCAAGACCGGGACAAATGGGGAAATTCGCCGTGTTTGCTCTGCGATTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCACCTCACAATTCATAGTCACCCTTGTCCTAGCAATGTCTGCCCTATCCGTTATGGTCCATGGACAGGGAACCCGGGTCGGGTTCTACTCAACCAGCTGCCCTCGGGTCGAGACC
ATAGTCCGAACCGCGGTCCAATCCCACTTCGCCTCCGACCCTACGGTGGCTGCAGGCTTGCTCAGGATGCATTTCCACGACTGTTTCGTGCAGGGCTGCGACGCTTCCGTCCTTATCTCT
GGAACCGGTACCGAGAGAACCGCCGTCCCTAATCAGTCCCTCAACGGCTTCTCAGCCATTGATGATGCCAAGACTCAGCTCGAAACTGCTTGTCCTGGCGTCGTCTCCTGCGCTGATATC
CTCGCTCTAGCTGCTCGCGACTCCGTCGTTTTG
ACAAGCGGACTAAGCTGGCCAGTTCCCACGGGACGAAGAGACGGCAGAGTTTCAGTCCAACAGGAAGCTGACGACAATTTGCCAGGA
CCAGCGGATACCGTCGATTCGCAGATCCGGCAGTTTAGCACTCTCGGCCTCAACGTTCAGGATCTCGTTACTCTCTCAGCTGGACACACTCTGGGGACAGCATCCTGCGCTACATTCAGC
TACAGGCTCTACAACTACAACAACACGGGCGGACCCGACCCGTCGATCGCTCCCGCATTCCTCACCACGCTCCGGTCATTCTGCCCGCAGAACGGCGACGGATCGAGGCGGGTGGCGATG
GACACCGGCAGCCAGAACCGGTTTGACAACTCGTATTTTACCAACATCAGGAACGGCCGTGGAGTTCTGGAGTCCGACCAGCGGGTGGTGGTGGACCCCCCGGCGGGACGCGTGGTGGGG
GGGGGGGGGGTAGTGTCTGGGTGGCGGTATTTGGGCCTCAGTGGGCTTCTTGGGCTTACTTTCAATGTTGAGTTTGGGAGGTCCATGGTGAAGATGAGTAATATTGGTGTCAAGACCGGG
ACAAATGGGGAAATTCGCCGTGTTTGCTCTGCGATTAATTAG

Retrieve as FASTA