Entry information : LuPrx117(Lus10020994|PACid:23182345)
Entry ID 12075
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx117(Lus10020994|PACid:23182345)
Name LuPrx117(Lus10020994|PACid:23182345)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx117
start..stop
S start..stop
LuPrx126 574 0 1..340 1..317
PpePrx08 463 2e-165 35..340 27..332
MePrx117 462 5e-165 1..340 1..333
NtPrx36-1A 456 1e-162 34..340 20..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14223..14480 258 N° 2 13638..13829 192 N° 3 13366..13531 166 N° 4 12874..13280 407
complement(join(12874..13280,13366..13531,13638..13829,14223..14480))


exon

Literature and cross-references LuPrx117(Lus10020994|PACid:23182345)
DNA ref. Phytozome 12:   scaffold155 (14480..12874)
Protein sequence: LuPrx117(Lus10020994|PACid:23182345)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (314)
PWM (Da):   %s   36748.18 (33750.7)  
PI (pH):   %s   6.88 (6.74) Peptide Signal:   %s   cut: 27 range:27-340
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSYTNFLAFTTSLLVIAFSTLHQVTPFPSSSSSSPSSSGPLDYSYYDQSCPRLSMIVRYGVWSAVNNESRIAASLLRLHFHDCFVNGCEGSILLDDTVGFKGEKNAQANRGSARGYEVIDNIKADVEKACPGTVSCTDILALAAREAVVLTGGPYWPVALGRRDTLTASEAAVGQQLPSPIESLDAITAKFNSKGLDLKDVVVLSGAHTLGFAQCFLIKRRLFNFKESGKPDPALDSSALTNLQGKCPNKNESNSNLVQLDSTTTRFDNMYYTNLVNNAGLLDSDQALLMNPTTGDMVRSYSSNQYSFYSDFKASMMKMGSVGVLTGKDGEIRRKCGSVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTACACAAACTTCTTAGCCTTCACTACTTCACTTCTTGTTATAGCTTTCTCTACACTTCATCAAGTCACTCCTTTCCCTTCTTCTTCTTCTTCTTCTCCTTCTTCTTCCGGACCT
CTCGATTACAGCTACTACGACCAATCGTGCCCTCGTCTATCCATGATCGTTCGATACGGTGTATGGTCGGCGGTCAACAATGAGTCCAGAATTGCTGCTTCGTTGCTCCGTCTACACTTC
CACGATTGTTTTGTCAAT
GTAAATATACATTCAAATATTCACTACTACAAAAAACTAGTCATTTAACCATCTATCTTTTATTTTATTACCAAACGGATGTTAAAGAGTATAACGTTAAAA
ATCTTAACATGTGACGTAGATTGCTAATTTTAACAGTGGTTAGAATCCGTTGATAAATAGTCAGTTTGGGGGCATGCTCTTAAATGACTCATCTAAGAGCGGTTGGTAACTGGATGTTAA
ATACACTCACTTTAAGAACGATCATTCACTAAAAAGGTCCACACCTAACAATACCGGTCCTTTGGCTACTGTTAAAAGTCGTCGTTAAATGAGCCTAGTTTATTGTATTGATCTCTCCGT
TTCACTAACTATAGAGTCTCGATTTTGACTACCATGTTCACGATGTAATAGGGGTGCGAGGGTTCGATCCTGCTGGACGACACGGTAGGTTTCAAAGGGGAGAAGAACGCACAAGCGAAT
CGTGGTTCAGCTAGAGGGTACGAGGTTATAGACAACATCAAAGCTGATGTCGAGAAGGCTTGTCCAGGCACGGTCTCATGCACCGACATACTGGCTCTAGCAGCAAGAGAAGCTGTTGTT
TTG
GTAAAAAAAAAGATTGCTTAATCAACTATAATAATCACATTGGATTATCGATACTAATAGACCCAACACTGATGAGCCATTGAACCAAATTCTGACGTTTTTCCAGACAGGAGGGCC
TTATTGGCCAGTTGCATTAGGGAGGAGAGACACGTTGACTGCTAGTGAAGCAGCCGTTGGTCAACAGTTGCCATCTCCTATCGAGTCCTTGGATGCCATCACTGCAAAGTTCAATTCCAA
GGGCCTTGACCTTAAGGATGTTGTTGTCCTCTCAG
GTTTGAATCAACTCGAAATGATCCAAAATATCATCGTCCCAACAACTTGAGTTAAATTCCGATTGTACATGATTCGAAATTGCAG

GAGCACACACGTTAGGATTTGCACAGTGCTTTCTGATAAAGAGGAGGCTATTCAACTTCAAGGAATCCGGCAAGCCAGACCCGGCACTCGATTCCTCTGCGCTGACGAACCTGCAGGGGA
AATGTCCGAACAAGAACGAGTCGAACTCGAACCTCGTCCAGCTCGATTCGACCACGACCCGGTTCGACAACATGTACTACACCAACCTCGTAAACAATGCTGGCCTGCTGGACTCGGATC
AAGCCCTGTTGATGAACCCGACAACTGGGGACATGGTCCGGTCCTATAGCTCGAACCAGTATTCATTCTACAGCGACTTCAAAGCATCGATGATGAAGATGGGCAGCGTTGGTGTGCTCA
CTGGGAAGGATGGTGAGATCAGAAGGAAATGTGGATCTGTGAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTACACAAACTTCTTAGCCTTCACTACTTCACTTCTTGTTATAGCTTTCTCTACACTTCATCAAGTCACTCCTTTCCCTTCTTCTTCTTCTTCTTCTCCTTCTTCTTCCGGACCT
CTCGATTACAGCTACTACGACCAATCGTGCCCTCGTCTATCCATGATCGTTCGATACGGTGTATGGTCGGCGGTCAACAATGAGTCCAGAATTGCTGCTTCGTTGCTCCGTCTACACTTC
CACGATTGTTTTGTCAAT
GGGTGCGAGGGTTCGATCCTGCTGGACGACACGGTAGGTTTCAAAGGGGAGAAGAACGCACAAGCGAATCGTGGTTCAGCTAGAGGGTACGAGGTTATAGAC
AACATCAAAGCTGATGTCGAGAAGGCTTGTCCAGGCACGGTCTCATGCACCGACATACTGGCTCTAGCAGCAAGAGAAGCTGTTGTTTTG
ACAGGAGGGCCTTATTGGCCAGTTGCATTA
GGGAGGAGAGACACGTTGACTGCTAGTGAAGCAGCCGTTGGTCAACAGTTGCCATCTCCTATCGAGTCCTTGGATGCCATCACTGCAAAGTTCAATTCCAAGGGCCTTGACCTTAAGGAT
GTTGTTGTCCTCTCAG
GAGCACACACGTTAGGATTTGCACAGTGCTTTCTGATAAAGAGGAGGCTATTCAACTTCAAGGAATCCGGCAAGCCAGACCCGGCACTCGATTCCTCTGCGCTG
ACGAACCTGCAGGGGAAATGTCCGAACAAGAACGAGTCGAACTCGAACCTCGTCCAGCTCGATTCGACCACGACCCGGTTCGACAACATGTACTACACCAACCTCGTAAACAATGCTGGC
CTGCTGGACTCGGATCAAGCCCTGTTGATGAACCCGACAACTGGGGACATGGTCCGGTCCTATAGCTCGAACCAGTATTCATTCTACAGCGACTTCAAAGCATCGATGATGAAGATGGGC
AGCGTTGGTGTGCTCACTGGGAAGGATGGTGAGATCAGAAGGAAATGTGGATCTGTGAATTAG

Retrieve as FASTA