Entry information : LuPrx12(Lus10001228|PACid:23148486)
Entry ID 12076
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx12(Lus10001228|PACid:23148486)
Name LuPrx12(Lus10001228|PACid:23148486)
Class Class III peroxidase    [Orthogroup: Prx037]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx12
start..stop
S start..stop
LuPrx198 665 0 1..345 1..345
MePrx118 481 3e-172 1..342 4..344
PtPrx62 459 8e-163 16..342 71..398
PpePrx71 452 1e-160 19..342 26..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 78258..78542 285 N° 2 77623..77965 343 N° 3 76842..77251 410  
complement(join(76842..77251,77623..77965,78258..78542))


exon

Literature and cross-references LuPrx12(Lus10001228|PACid:23148486)
DNA ref. Phytozome 12:   scaffold1649 (78542..76842)
Protein sequence: LuPrx12(Lus10001228|PACid:23148486)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346
PWM (Da):   %s   38297.91  
PI (pH):   %s   6.36
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTFVFIFAILCFRSALADVNSDENNNNDEAITLQVSTLLDTSSSDNDLLSFAYYQGTCPEAEGIINRKVRDWAKKDSTLAASLMRLHFHDCAVRGCDASILLSNVGSERTAHASKTLRGFEVIDDIKKELESKCPKTVSCADILTAASRDATVIMGGPYWSIPYGRKDGKVSIEKEAELVPMGRENITTLIQFYQSKGLNVLDLVALSGAHTIGRASCGAIQDRIYYYKGSGESDSSMDKKYSNYLTRKCRWGSDYVELDAITPDKFDNQYYKNLQRKMGLLRTDQAMYADSRTSPFVNALAYAPPSVFYNQFAASMAKLGNVVEVVGDGEVRTNCNYVNSVHY*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGACCTTCGTTTTCATCTTCGCCATTCTTTGCTTCCGATCGGCATTGGCCGATGTCAACTCCGACGAAAACAACAACAACGATGAAGCAATAACACTACAAGTGTCGACGTTGCTC
GACACTTCTTCCTCCGACAATGATTTGCTGTCATTTGCCTACTACCAGGGTACTTGCCCCGAAGCTGAAGGCATTATCAACCGTAAAGTTCGTGATTGGGCCAAAAAGGATTCGACTCTC
GCTGCTAGCCTCATGCGCCTCCACTTTCACGACTGTGCCGTTAGG
GTAATTACTAATTAGCACCATATATTGTTTTTACTTCACTTTTTTATGGTGGGTTAAATTCGTCCACTCCTAATT
CTGTCATTATAGTTATTTACAATTGACTTGCATTTATAAATAATATATATTATTACTGGCGTGTTGTTATAATTTATTTTTTTTAAATGTTGGTTTTTAGGTAAATGGTTCACTTTAATT
GTACAATTAGTTTGTCCTAAATATTATTAAAAAAAAATCAATTCCAAATTTCTGCTTATGCCATTGTCTATAATTATTTATATGAACTTATTTGCAGGGTTGTGATGCTTCAATTCTACT
GAGCAACGTAGGAAGCGAGAGGACAGCACATGCCAGCAAGACCCTGCGTGGGTTTGAAGTGATAGACGACATCAAGAAGGAACTCGAAAGCAAGTGCCCCAAAACGGTGTCGTGCGCCGA
CATTCTGACCGCAGCCTCACGAGACGCTACCGTTATTATGGGAGGTCCGTACTGGTCAATTCCCTACGGGAGAAAAGACGGGAAAGTTTCTATCGAAAAGGAAGCCGAATTGGTGCCGAT
GGGTCGCGAAAACATTACCACCCTCATCCAGTTCTATCAGTCTAAAGGCCTCAACGTGCTTGATCTTGTTGCTCTCTCAG
GTATTAGACATTCAGTTGATTCGATAGTTCTCGTTTAATT
ATTGTTACGGTGCATCAATTTCCTCTATGATTTCTGTCAAATATGTCATGTCACATCAACATACCATGTCATCAAACTAAACAGCAAACTTATGATATGTACGATGTCACATAATGGTCA
TTTATTTTTCACGACATGATGACACATTTTTATTGGACTTGGAGTATTATAGTTACCATATTTTCAATTACATGGTACGTGGACATGACATATTTGACAAAAAATCGTTACAAAATCATT
AGATACTGCTCAATTTGTAGTTTCAAAATTGAGATTCATTAAGCAAAACCAATCCTAACTAGATCAGGATTTGTTGTGTGTACATTTGCAGGAGCGCATACAATTGGTCGGGCGAGCTGC
GGGGCGATTCAGGACCGGATCTACTACTACAAAGGAAGTGGAGAATCAGATTCATCGATGGACAAGAAATACTCAAACTATCTTACCAGGAAATGCAGGTGGGGTTCGGACTACGTTGAG
CTTGATGCCATAACGCCAGACAAGTTCGACAACCAGTACTACAAGAATCTACAGAGGAAGATGGGACTCTTGCGGACTGATCAAGCCATGTACGCTGATTCCAGGACTTCCCCCTTCGTC
AACGCGTTGGCTTACGCGCCACCTTCGGTGTTTTACAACCAGTTCGCTGCGTCAATGGCCAAGCTTGGCAATGTAGTTGAGGTTGTGGGTGATGGCGAGGTGCGGACCAACTGCAATTAT
GTCAACTCTGTCCATTACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGACCTTCGTTTTCATCTTCGCCATTCTTTGCTTCCGATCGGCATTGGCCGATGTCAACTCCGACGAAAACAACAACAACGATGAAGCAATAACACTACAAGTGTCGACGTTGCTC
GACACTTCTTCCTCCGACAATGATTTGCTGTCATTTGCCTACTACCAGGGTACTTGCCCCGAAGCTGAAGGCATTATCAACCGTAAAGTTCGTGATTGGGCCAAAAAGGATTCGACTCTC
GCTGCTAGCCTCATGCGCCTCCACTTTCACGACTGTGCCGTTAGG
GGTTGTGATGCTTCAATTCTACTGAGCAACGTAGGAAGCGAGAGGACAGCACATGCCAGCAAGACCCTGCGTGGG
TTTGAAGTGATAGACGACATCAAGAAGGAACTCGAAAGCAAGTGCCCCAAAACGGTGTCGTGCGCCGACATTCTGACCGCAGCCTCACGAGACGCTACCGTTATTATGGGAGGTCCGTAC
TGGTCAATTCCCTACGGGAGAAAAGACGGGAAAGTTTCTATCGAAAAGGAAGCCGAATTGGTGCCGATGGGTCGCGAAAACATTACCACCCTCATCCAGTTCTATCAGTCTAAAGGCCTC
AACGTGCTTGATCTTGTTGCTCTCTCAG
GAGCGCATACAATTGGTCGGGCGAGCTGCGGGGCGATTCAGGACCGGATCTACTACTACAAAGGAAGTGGAGAATCAGATTCATCGATGGAC
AAGAAATACTCAAACTATCTTACCAGGAAATGCAGGTGGGGTTCGGACTACGTTGAGCTTGATGCCATAACGCCAGACAAGTTCGACAACCAGTACTACAAGAATCTACAGAGGAAGATG
GGACTCTTGCGGACTGATCAAGCCATGTACGCTGATTCCAGGACTTCCCCCTTCGTCAACGCGTTGGCTTACGCGCCACCTTCGGTGTTTTACAACCAGTTCGCTGCGTCAATGGCCAAG
CTTGGCAATGTAGTTGAGGTTGTGGGTGATGGCGAGGTGCGGACCAACTGCAATTATGTCAACTCTGTCCATTACTGA

Retrieve as FASTA