Entry information : LuPrx126(Lus10023858|PACid:23160830)
Entry ID 12080
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx126(Lus10023858|PACid:23160830)
Name LuPrx126(Lus10023858|PACid:23160830)
Class Class III peroxidase     [Orthogroup: Prx022]*
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx126
start..stop
S start..stop
LuPrx117 574 0 1..317 1..340
PpePrx08 400 5e-141 38..317 27..332
RcPrx31 400 6e-141 1..317 1..335
NtPrx36-1B 399 8e-141 22..317 6..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 198936..199124 189 N° 2 199549..199740 192 N° 3 199865..200030 166 N° 4 200115..200521 407
join(198936..199124,199549..199740,199865..200030,200115..200521)


exon

Literature and cross-references LuPrx126(Lus10023858|PACid:23160830)
DNA ref. Phytozome 12:   scaffold177 (198936..200521)
Protein sequence: LuPrx126(Lus10023858|PACid:23160830)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (290)
PWM (Da):   %s   34268.01 (31205.4)  
PI (pH):   %s   6.51 (6.02) Peptide Signal:   %s   cut: 28 range:28-317
Sequence 359
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGYTNFLAFTTSVLVLITLSTLHQVTPFPSAAYSSSSPSSSGPLDYNYYDQSCPRLSMIVRYGGCEGSILLDDTVAFKGEKNAQANRGSARGYEVIDSIKSDVEKACPGTVSCTDILALAAREAVVMTGGPYWPVALGRRDTLTAREAAVGQQLPSPIESLDDITAKFNSKGLDLKDVVVLSGAHTLGFAQCFLIKRRLFNFKESGKPDPALDSSTLTNLQGKCPNKNESNSILVQLDSTTTRFDNMYYTNLVNNAGLLDSDQALLMNPTTGDMVRSYSSNQYLFYSDFKASMMKMGSVGVLTGKDGEIRRKCGSVN*

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction. Gap is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGGTTACACAAACTTCTTAGCCTTCACTACTTCAGTACTTGTTCTTATAACTTTGTCTACCCTTCATCAAGTCACTCCTTTCCCTTCTGCTGCATATTCTTCTTCTTCTCCTTCTTCTT
CCGGACCTCTCGATTACAACTACTACGACCAGTCGTGCCCTCGTCTGTCCATGATCGTTCGGTATGGT
GTATGGTCAGAATTGCTGCTTCGTTGCTCCGTCTACACTTTCACGATTGTTT
CGTCAATGTAAATATACATACAAATTCACTAGAAACTAGCTCTTTTATTTTATTACCAAATCCCTGTTAAAGGGTATAATGTTAAAAATCTTAAAAAATGTAATGTAAATTATTAATTTT
AACGGTGGTTAGAATCTGTTGATAAAAGGTCAGTTTGGGGGCAATGCTCTTAAATAATTCTCTTAGGGGCGGTTGGCAACTAGCTGTTAAATGAACTCACTTTAAGAACGGTCAACTCAA
CCACTAAAAAGACTCACACCTAACAATATGAATAAAAGTCGTCGTTAAATGAGCCCAATTTCTTATAATGATCTTTCTGTTTCACTAACTATTGAGTTTCGATTTTGACTACCATGTTGA
TGATGATAACAGGGTTGCGAGGGTTCGATCCTGCTGGACGACACGGTAGCTTTCAAGGGGGAGAAGAATGCACAAGCGAATCGTGGTTCCGCCAGAGGGTACGAGGTTATAGACAGCATC
AAATCTGATGTCGAAAAGGCTTGTCCAGGCACGGTCTCATGCACCGACATATTGGCTCTAGCAGCGAGAGAAGCTGTTGTTATG
GTAACAAAAAAATGATTGCTTAATCAACCATGATAA
TTACATCGCTAATCATTCCTATCAAATTATGAAACTTGATGGGTTGAACACCGATGAGTCACTGAACCAAATTCTGACGTTATGACAGACAGGAGGGCCTTATTGGCCAGTTGCATTAGG
GAGGAGAGACACGTTGACTGCCAGGGAAGCAGCAGTTGGTCAACAGTTGCCATCTCCTATAGAGTCATTGGATGACATCACCGCAAAGTTCAATTCCAAGGGCCTTGACCTTAAGGATGT
TGTTGTCCTTTCAG
GTTCGATACCCAACTCGAAACGATCTAAAATATCATCCCAACAACTCGAGTTAAAATCCGATTGTACATGATTTGAAATTGCAGGAGCACACACGTTAGGATTTGC
ACAGTGCTTTCTGATAAAGAGGAGGCTATTCAACTTCAAGGAATCGGGCAAGCCAGACCCGGCACTCGATTCCTCTACGCTGACGAACCTGCAGGGGAAATGTCCGAACAAGAACGAGTC
GAACTCGATCCTCGTCCAGCTCGATTCGACAACGACCCGGTTCGACAACATGTACTACACCAACCTCGTAAACAATGCTGGCCTGCTCGACTCGGATCAAGCCCTGCTGATGAACCCGAC
AACCGGGGACATGGTCCGGTCCTATAGCTCGAACCAGTATTTGTTCTACAGCGACTTCAAAGCATCGATGATGAAGATGGGCAGCGTTGGTGTGCTCACTGGGAAGGATGGTGAGATCAG
AAGGAAATGTGGATCTGTGAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGGTTACACAAACTTCTTAGCCTTCACTACTTCAGTACTTGTTCTTATAACTTTGTCTACCCTTCATCAAGTCACTCCTTTCCCTTCTGCTGCATATTCTTCTTCTTCTCCTTCTTCTT
CCGGACCTCTCGATTACAACTACTACGACCAGTCGTGCCCTCGTCTGTCCATGATCGTTCGGTATGGT
GGTTGCGAGGGTTCGATCCTGCTGGACGACACGGTAGCTTTCAAGGGGGAGA
AGAATGCACAAGCGAATCGTGGTTCCGCCAGAGGGTACGAGGTTATAGACAGCATCAAATCTGATGTCGAAAAGGCTTGTCCAGGCACGGTCTCATGCACCGACATATTGGCTCTAGCAG
CGAGAGAAGCTGTTGTTATG
ACAGGAGGGCCTTATTGGCCAGTTGCATTAGGGAGGAGAGACACGTTGACTGCCAGGGAAGCAGCAGTTGGTCAACAGTTGCCATCTCCTATAGAGTCAT
TGGATGACATCACCGCAAAGTTCAATTCCAAGGGCCTTGACCTTAAGGATGTTGTTGTCCTTTCAG
GAGCACACACGTTAGGATTTGCACAGTGCTTTCTGATAAAGAGGAGGCTATTCA
ACTTCAAGGAATCGGGCAAGCCAGACCCGGCACTCGATTCCTCTACGCTGACGAACCTGCAGGGGAAATGTCCGAACAAGAACGAGTCGAACTCGATCCTCGTCCAGCTCGATTCGACAA
CGACCCGGTTCGACAACATGTACTACACCAACCTCGTAAACAATGCTGGCCTGCTCGACTCGGATCAAGCCCTGCTGATGAACCCGACAACCGGGGACATGGTCCGGTCCTATAGCTCGA
ACCAGTATTTGTTCTACAGCGACTTCAAAGCATCGATGATGAAGATGGGCAGCGTTGGTGTGCTCACTGGGAAGGATGGTGAGATCAGAAGGAAATGTGGATCTGTGAATTAG

Retrieve as FASTA