Entry information : LuPrx141(Lus10026903|PACid:23142887)
Entry ID 12091
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx141(Lus10026903|PACid:23142887)
Name LuPrx141(Lus10026903|PACid:23142887)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx141
start..stop
S start..stop
LuPrx108 628 0 1..332 1..332
PtPrx52 473 1e-169 12..325 22..333
RcPrx44 471 8e-169 12..325 12..326
PtPrx79 462 2e-165 12..325 20..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 452116..452328 213 N° 2 452411..452756 346 N° 3 453605..454044 440  
join(452116..452328,452411..452756,453605..454044)


exon

Literature and cross-references LuPrx141(Lus10026903|PACid:23142887)
DNA ref. Phytozome 12:   scaffold651 (452116..454044)
Protein sequence: LuPrx141(Lus10026903|PACid:23142887)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (308)
PWM (Da):   %s   35439.74 (32877.3)  
PI (pH):   %s   4.54 (4.53) Peptide Signal:   %s   cut: 25 range:25-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSSATSPLPLLLLILILPNSSSATLSFDFYSSSCPAVNLIVSNTVRTASSDDPSIPGKLLRLLFHDCFVDGCDGSVLLEGNSTERSDPANGSLGGFEVIDSAKRVLEVFCPGIVSCADILALAARDAVVISGGPDTQIPMGRRDGLVSSVLNVRPNIVDTSFTMPEMVKIFSSKGLSLDDLVVLSGAHTIGSAHCGAFSDRFHTDPKGKLNVIDSSLDANYAKDLIQKCPAGANNPSVTVANDPETSSVFDNQYYRNLLGHKGLFQSDSVLLEDKQTSKLVRDLAADEEAFFERWSESFVKLTSVGVKTGEEEGEIRASCSVTNSNMNRKK*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTTCAGCAACCTCACCACTTCCTCTTCTGCTCCTTATTCTCATTCTCCCCAACTCTTCTTCTGCGACACTGTCCTTTGACTTCTACTCATCCTCCTGCCCTGCCGTCAACTTG
ATTGTATCCAACACAGTCAGGACAGCTTCCTCCGACGACCCATCTATCCCCGGGAAGCTCCTCCGCTTGCTCTTCCATGACTGCTTCGTCGAC
GTAACAACATAAAGATTCAGTCTTTAA
CCAATTTTCTGCTTCCTGGCTACTTGATAATCATAAACATACAATCTTTTTTCAGGGTTGCGATGGATCTGTGCTTCTAGAAGGGAACTCGACGGAGAGGAGTGACCCGGCCAATGGGTC
GCTGGGAGGGTTCGAAGTGATCGATTCGGCGAAGAGGGTGCTGGAGGTGTTCTGTCCTGGCATTGTATCTTGTGCTGATATTCTGGCTCTGGCTGCTAGAGATGCTGTTGTAATCTCTGG
AGGACCGGATACTCAAATTCCAATGGGGAGAAGAGATGGGTTGGTTTCGTCTGTATTGAATGTTAGACCAAACATTGTGGACACTAGCTTCACCATGCCTGAAATGGTCAAGATCTTCTC
CTCCAAAGGTCTCTCTCTGGATGACCTCGTCGTTTTATCTG
GTAAGCCTATTTGCTCCACCCCACTTTCGGTCCCAAGAATTGAAATTTATATGTTAGTGATCTTTTCGAATTTCGTCCG
GTGCATTTTTAGTTTCGACTTATTGTTTAGCCATAGACTGAACAAGGAGTTGTGGAGAGTCTTAGACTTTCTTTTTTCCTAGTCATGAATACTAAATTATATTTGAAATTTAGACATTTT
CATCATTTAACTCAATTCTATATGAAGTTCCACTCTCCTATTTATTTGTTTAGATCGTGTTATTTATTAAATTCAATTATTACCCCCAATGAACTACTAACCATACATTTAATCAAAATA
GACCGAATTCAAAAATAATAAACCATCGGTGGCACATTAAAACCGGTTTCAACAAAAAATGCATGGTGATTAGGATTTTTTTTATACATTAAGGGCTTTGTTTTCTACTCAAAAGCGGAC
GGAATTCAGTTTTAAAGGCATATGTTGGATTTGTCCAAATCCGGATCTCTCCAAACGAACTTTAGAGGTTGGAATTAGGCAGAAGCCTTCAAATTTGACATGATTGGGGATGTTGCTTTA
TGGTTGTGGAAAATATATTTAGCCGAATTTATTGAATATTTAGAATTGAGTCCTAAATTCAACCAATAAAATGTGTCACAGAAACCGAACCTTAATATTTGGTTCAAAAAATAGGTTTAG
GAAAATGAATTTGTCATTCTATTAAAAAATCAATAACAATAGAAATTTGTTTGATTCAAAATAGACTCGGTACATGTCTCGGTCTTGATTACACACACCCCCGACTAGTTGAGTGTGTTT
TGTAACTTAATTACTAAGGTGGGTTTGCTTGTTTGTGTTTTAACTTCAGGAGCTCACACAATAGGATCAGCCCATTGCGGAGCATTCAGCGACCGATTCCACACAGATCCAAAAGGGAAA
CTGAATGTGATCGATTCCTCACTGGACGCTAACTACGCAAAGGACTTGATCCAGAAATGCCCAGCCGGAGCAAATAACCCGTCGGTAACAGTTGCGAACGACCCGGAAACATCTTCAGTG
TTCGACAACCAGTACTACAGGAACCTGTTGGGACACAAGGGTCTGTTCCAGTCAGATTCCGTGCTGCTGGAGGACAAACAGACGAGTAAATTGGTGCGAGATTTGGCGGCGGATGAGGAG
GCATTTTTCGAGAGGTGGAGCGAGTCCTTCGTGAAGCTTACTAGTGTTGGTGTGAAGACCGGCGAGGAAGAAGGAGAAATTCGAGCTTCTTGTTCCGTTACTAATAGTAATATGAATAGG
AAGAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTCTTCAGCAACCTCACCACTTCCTCTTCTGCTCCTTATTCTCATTCTCCCCAACTCTTCTTCTGCGACACTGTCCTTTGACTTCTACTCATCCTCCTGCCCTGCCGTCAACTTG
ATTGTATCCAACACAGTCAGGACAGCTTCCTCCGACGACCCATCTATCCCCGGGAAGCTCCTCCGCTTGCTCTTCCATGACTGCTTCGTCGAC
GGTTGCGATGGATCTGTGCTTCTAGAA
GGGAACTCGACGGAGAGGAGTGACCCGGCCAATGGGTCGCTGGGAGGGTTCGAAGTGATCGATTCGGCGAAGAGGGTGCTGGAGGTGTTCTGTCCTGGCATTGTATCTTGTGCTGATATT
CTGGCTCTGGCTGCTAGAGATGCTGTTGTAATCTCTGGAGGACCGGATACTCAAATTCCAATGGGGAGAAGAGATGGGTTGGTTTCGTCTGTATTGAATGTTAGACCAAACATTGTGGAC
ACTAGCTTCACCATGCCTGAAATGGTCAAGATCTTCTCCTCCAAAGGTCTCTCTCTGGATGACCTCGTCGTTTTATCTG
GAGCTCACACAATAGGATCAGCCCATTGCGGAGCATTCAGC
GACCGATTCCACACAGATCCAAAAGGGAAACTGAATGTGATCGATTCCTCACTGGACGCTAACTACGCAAAGGACTTGATCCAGAAATGCCCAGCCGGAGCAAATAACCCGTCGGTAACA
GTTGCGAACGACCCGGAAACATCTTCAGTGTTCGACAACCAGTACTACAGGAACCTGTTGGGACACAAGGGTCTGTTCCAGTCAGATTCCGTGCTGCTGGAGGACAAACAGACGAGTAAA
TTGGTGCGAGATTTGGCGGCGGATGAGGAGGCATTTTTCGAGAGGTGGAGCGAGTCCTTCGTGAAGCTTACTAGTGTTGGTGTGAAGACCGGCGAGGAAGAAGGAGAAATTCGAGCTTCT
TGTTCCGTTACTAATAGTAATATGAATAGGAAGAAGTGA

Retrieve as FASTA