Entry information : LuPrx149 (Lus10027984|PACid:23181122)
Entry ID 12096
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-18 (Christophe Dunand)
Peroxidase information: LuPrx149 (Lus10027984|PACid:23181122)
Name (synonym) LuPrx149 (Lus10027984|PACid:23181122)
Class Class III peroxidase    [Orthogroup: Prx121]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx149
start..stop
S start..stop
LuPrx01 657 0 5..354 8..359
LuPrx151 578 0 5..354 8..360
LuPrx42 570 0 14..354 18..372
LuPrx43 517 0 7..354 6..358
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 182238..182450 213 N° 2 183609..183800 192 N° 3 184373..184541 169 N° 4 184638..185128 491
join(182238..182450,183609..183800,184373..184541,184638..185128)


exon

Literature and cross-references LuPrx149 (Lus10027984|PACid:23181122)
Literature Day A, Fénart S, Neutelings G, Hawkins S, Rolando C, Tokarski C. Identification of cell wall proteins in the flax (Linum usitatissimum) stem. Proteomics. 2013 13(5):812-25.
DNA ref. Phytozome 12:   scaffold132 (182238..185128)
Protein sequence: LuPrx149 (Lus10027984|PACid:23181122)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355 (331)
PWM (Da):   %s   37638.68 (35084.5)  
PI (pH):   %s   4.76 (4.74) Peptide Signal:   %s   cut: 24 range:24-354
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASYKFVVSSLMAMLLCAGVSYAQQLTPTFYNSTCPTVISIVRTVLQNAAMADPRIGASLNRLHFHDCFVNGCDGSLLLDNSATILSEKQALGNNNSVRGFDVVDQMKTQVEAACPGVVSCADILAIASEESVVLAGGPSWAVPLGRRDSLTANRSLADDQLPPPFFTVDQLKANFATVGLNTTEDLVALSGAHTFGRARCVGFVGRLYNFNSTGGPDPTINATFLQTLRQICPQNGNGSVLTNLDRTTVDAFDSNYFTNLQTREGLLQTDQELISTPGSDTIALVNRFAANQTAFFQSFVNSMIRMGNIPPPPGSPSEIRRNCRVVNPASVADTIVITTPAGSVGTDGFASDM*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Experimental evidency of cell wall localization Warnings: The paralog 100012061 is in an intron of the proteins.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCATATAAGTTTGTAGTTTCTTCGTTGATGGCGATGCTGCTATGCGCCGGAGTGAGCTACGCGCAGCAGCTTACTCCGACGTTCTACAACTCGACTTGCCCGACTGTAATCAGC
ATCGTCCGTACAGTTCTTCAGAATGCTGCCATGGCCGATCCCAGAATCGGCGCCAGCCTCAACAGGCTTCACTTCCATGATTGCTTTGTTAAT
GTAAGTACACTACTACTGCGTACATGC
TCTCTATATGCTTGTACCATTCGTTACATGTTCTTGTAGTAGTAAAAAAATCCCATAGTAGTACAAGAATCTTTGGTGTTTGTTTACAATGGCGGAACTAGGGGCGGACTTGGTAACTGT
TTCGGACTCTTCCGATTTTTAAAGTGACGAAATTTTATTAAAATTTTATCAAGTACATTTACATATTTCGTCTCGTGTGTTTCCAACTTACTTCATAATTAAAATCCCACCCAGAATTTC
CTACCATTTTCGTTAGTTATATGTTCTTCTGATAGTAGCAAACAAAAATCATGGCATATTGCTTATAAGGTATAACAGGGAATTAGGGGCGAACTTAAGTCACGGTCCAGAATTTTTCGA
TTTTACTATTACGAAATCCTTTGTAAGATTTTGTGAATTTGGAGCTTTTGCCCAGTATATTTGCGCATTTCGACTACTGAGCTTTAAAACCTGCTACAAACATAAAATGATGTCGAAAAT
TGTAAACGATCGTTCTGATTCCGCTATTGATTGTTTACGAAAACAAGTATATATATGAACAAAAAAGCAAAAGGATACAAATTAGGGAAGAGACAATGAAAGGAATAGTTGGTAGAAGTT
TCAACCTCCCGTCATAAAGAAGAGGCCAAATGCTGAACTTTCAAACGTTGATATTTCTTTGGTCCATAATAGATATATTACCATGTGGTAATTAATTAAATTGTCGGTATTGGATATAAT
ATATGTTTTTGCTTTTATTTTCAAGTACAGAACAAAGTAGTATATTCCATTCCCATAAATTTAATTTATCAATGGTTTTTCAACCCTTCCGATATGGACCGTCCGATTTCAATGATCTAA
TGTAATCTAAATTTTATTATAGTTCACTCGTACATTTATAACGATATAAGCAGTTGAGTTTTGAAGAAATTAGACTGAATACGTGTTTGATGTTCTGAGATGGTCCTGAAAAACCATGCT
GTGTTATTTCTTTAATTTACATTTCTTCAAGTCTACATCCGAATTAAATTCCAGCTAGCAATGCATGCCTGGGGACAGGTATTGAATGCTACGTGATAGTGCTTATTATGGTTAGGGGGT
ATTGTATGTAATTTTCTTGATCTGAGGGTATGTATGTAATTTACAATGCAGGGATGTGATGGATCTTTGTTGCTGGACAACAGCGCCACCATACTAAGCGAGAAACAAGCTCTTGGTAAC
AACAACTCCGTTAGAGGCTTCGACGTCGTTGACCAAATGAAGACCCAAGTCGAAGCCGCTTGCCCCGGGGTTGTTTCTTGTGCCGATATTCTCGCCATCGCTTCCGAGGAATCCGTTGTT
TTG
GTATGTAAAATCTTCGTACGTACGTATAAATTCACCTAAAATGGAAAGAAGGGGGAAGAAAACAACGTCTAACTTAATTATAACGATTTAAGTGGTTAAGTCACTTATCATTAGACT
CACTGCTTCCACATTTCGATATGATTCCGAAATCTAGAACCTAATTTTCTAATTTTTTCCCATGTGGAACCTTGTCTTGTCAAAAAAAGCTAATTTATGAAAGATGGAAATAATTGACAT
ATAATATGGGTCAATAATAGTAACTAATTATGGTCCCTCGTGTCCCTTTTCTATACTTAGCCAAATTAAATGAATTGACAACTTTAATGTACAACAACCATGAACTACCCTTAGAGCTAG
GGCTTTTCTGATTGTGACTATTCAAAAATTTGTCTCAACAAATATACAAAGTCATATATATAGATGATTATTATTTTTAGTTGGATATGTAGTTAGAATTAATTTATTGCTTTTGAGATT
CGGTATTCGAAACTATATCGAATATGTGAAACTAATGATATGTGATTTAGTAGTTGATTGTTTGACGAATACTATGTAATTTACTAATGGTATAGGCAGGAGGGCCGTCATGGGCAGTTC
CACTAGGAAGGCGAGACAGCTTGACAGCAAACCGGAGTCTAGCAGATGACCAACTTCCTCCTCCATTCTTCACCGTCGATCAGCTCAAAGCTAATTTCGCTACAGTTGGCCTCAACACCA
CCGAAGACCTCGTTGCACTCTCGG
GTATCATAATACTATCTAGACCCTATCCATTATATCATCCCATGAATACTGTATTTATATTAATACTAATTAATTCATCGTTATGGGCTTAATTAG

GTGCTCACACATTCGGAAGGGCCCGGTGCGTAGGATTCGTGGGCCGGCTCTACAACTTCAACAGCACGGGCGGCCCAGACCCAACGATCAACGCCACCTTCCTCCAGACACTCCGCCAGA
TCTGCCCTCAGAACGGAAACGGCAGCGTTTTGACCAACCTTGACCGGACAACCGTCGACGCTTTCGATTCGAACTACTTCACCAATCTCCAGACCCGTGAAGGACTCCTCCAGACTGACC
AGGAACTCATCTCCACTCCGGGCTCCGACACTATTGCGCTCGTCAACAGGTTCGCCGCCAACCAGACGGCCTTCTTCCAGAGCTTTGTCAATTCCATGATTAGGATGGGGAACATTCCTC
CCCCGCCCGGGAGTCCGAGTGAGATTAGGCGGAATTGCAGGGTCGTTAACCCCGCCTCCGTCGCAGATACGATTGTTATTACTACCCCGGCGGGTTCTGTTGGTACGGATGGGTTTGCGA
GTGATATGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCATATAAGTTTGTAGTTTCTTCGTTGATGGCGATGCTGCTATGCGCCGGAGTGAGCTACGCGCAGCAGCTTACTCCGACGTTCTACAACTCGACTTGCCCGACTGTAATCAGC
ATCGTCCGTACAGTTCTTCAGAATGCTGCCATGGCCGATCCCAGAATCGGCGCCAGCCTCAACAGGCTTCACTTCCATGATTGCTTTGTTAAT
GGATGTGATGGATCTTTGTTGCTGGAC
AACAGCGCCACCATACTAAGCGAGAAACAAGCTCTTGGTAACAACAACTCCGTTAGAGGCTTCGACGTCGTTGACCAAATGAAGACCCAAGTCGAAGCCGCTTGCCCCGGGGTTGTTTCT
TGTGCCGATATTCTCGCCATCGCTTCCGAGGAATCCGTTGTTTTG
GCAGGAGGGCCGTCATGGGCAGTTCCACTAGGAAGGCGAGACAGCTTGACAGCAAACCGGAGTCTAGCAGATGAC
CAACTTCCTCCTCCATTCTTCACCGTCGATCAGCTCAAAGCTAATTTCGCTACAGTTGGCCTCAACACCACCGAAGACCTCGTTGCACTCTCGG
GTGCTCACACATTCGGAAGGGCCCGG
TGCGTAGGATTCGTGGGCCGGCTCTACAACTTCAACAGCACGGGCGGCCCAGACCCAACGATCAACGCCACCTTCCTCCAGACACTCCGCCAGATCTGCCCTCAGAACGGAAACGGCAGC
GTTTTGACCAACCTTGACCGGACAACCGTCGACGCTTTCGATTCGAACTACTTCACCAATCTCCAGACCCGTGAAGGACTCCTCCAGACTGACCAGGAACTCATCTCCACTCCGGGCTCC
GACACTATTGCGCTCGTCAACAGGTTCGCCGCCAACCAGACGGCCTTCTTCCAGAGCTTTGTCAATTCCATGATTAGGATGGGGAACATTCCTCCCCCGCCCGGGAGTCCGAGTGAGATT
AGGCGGAATTGCAGGGTCGTTAACCCCGCCTCCGTCGCAGATACGATTGTTATTACTACCCCGGCGGGTTCTGTTGGTACGGATGGGTTTGCGAGTGATATGTAG

Retrieve as FASTA