Entry information : LuPrx155(Lus10028688|PACid:23164579)
Entry ID 12102
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx155(Lus10028688|PACid:23164579)
Name LuPrx155(Lus10028688|PACid:23164579)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx155
start..stop
S start..stop
LuPrx158 577 0 30..338 1..305
MePrx89 409 3e-144 10..338 8..334
MePrx80 407 4e-143 10..338 8..334
EgrPrx151 404 1e-142 22..338 1..315
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 840809..841048 240 N° 2 839835..840284 450 N° 3 839391..839717 327  
complement(join(839391..839717,839835..840284,840809..841048))


exon

Literature and cross-references LuPrx155(Lus10028688|PACid:23164579)
DNA ref. Phytozome 12:   scaffold346 (841048..839391)
Protein sequence: LuPrx155(Lus10028688|PACid:23164579)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (305)
PWM (Da):   %s   36432.27 (32590.3) Transmb domain:   %s   i9-31o
PI (pH):   %s   8.74 (8.91) Peptide Signal:   %s   cut: 34 range:34-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTHPHHQPPSLLLLPITLLVLLFMFMSMSMAEASLKPGFYKSSCPSAEAIVKRVVTRAVSRDSNLGAGIIRMYFHDCFIRGCDGSVLLKSTPGGNQTERDHPANNPSLRGFEVIDSAKLELESVCPNTVSCADIIAFAARDSSFVLGRINYAVPAGRPAGGRAGRFSSFDDIGTNLPPPSFSAEQLAQNFARKGLTTEEMVVLSGAHSIGVAHCSSFANRLYSFNGTHPQDPTLDSTYATELKRRCPNGGGNAVVDLDSTANRLDNRYFADLKRWRGILSSDQTLMDSTLTRNIATKFASGNGGAWAGRYAKAMVKMGSIEVLTGNQGEIRKICSVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTCACCCTCATCATCAACCACCATCACTACTCTTACTTCCCATCACATTACTAGTACTTCTCTTCATGTTCATGTCCATGTCCATGGCCGAGGCTTCTCTGAAGCCGGGCTTCTAC
AAGTCATCGTGCCCATCGGCTGAGGCCATCGTCAAGAGGGTCGTCACCAGGGCCGTGTCTCGTGATTCAAACCTTGGGGCCGGCATCATCAGGATGTACTTCCACGACTGCTTTATCAGG
GTACGTCTGTCTAGCTTAATTAGCTCTTCTCCTTTTCCATCTTTCATGGTTCAGATTCTACGGGGGATAGTTCATTCATCCTACAATAGTCTGCTTGTAGCCATGCAACTGCAGTTTTAG
AGACGGTAACTTTGCGACCGTTTTACAACAACGCTTACTAACTTGCTGGTTACTTAAGATCACGGGTGACCGTTTTGGCCGGTGACCGAATAATATAAAATGCCAAATATGAACCCTTTC
TCAATAATTCAGGTTATTGGGATACAACGGTTCTTGACAAATCGAATAGCTAATCAGTTTGATAGTATGGATAAACTCAATTGACCATAGTCAAAGTTTTGATCTTATTGTAGTTGGTAG
AATTTGATTAAGATCATATGCAGTGTAAGATTAAGTTACTATAGTGTATCAACTTTATGCTAGGGTAAATGGTTCGATCAGTTGGTTCAAATCAATTGGTTTGATTAATTTTGGTTAGAT
TAAACTTGTTAGTATACAATTAATTTATTGATTTTAATAATTAGGGATGTGACGGATCTGTCCTCCTGAAGTCCACTCCGGGAGGTAACCAAACCGAGAGAGACCATCCGGCCAACAACC
CAAGCCTACGAGGATTCGAGGTAATCGACTCGGCCAAATTGGAACTCGAATCGGTCTGCCCAAACACTGTCTCCTGCGCCGACATTATCGCCTTCGCCGCTCGGGACAGCTCATTCGTCC
TCGGACGCATCAACTACGCCGTCCCCGCCGGTCGGCCCGCCGGTGGTCGTGCCGGCCGCTTCTCGTCTTTCGACGACATCGGTACGAACCTCCCGCCTCCGAGCTTCTCGGCAGAGCAAT
TGGCTCAGAATTTCGCCCGAAAGGGGTTGACCACTGAGGAGATGGTGGTACTCTCCGGTGCCCACTCGATCGGTGTGGCCCACTGCTCGTCATTCGCTAATCGGCTCTACTCATTCAATG
GGACCCACCCGCAG
GTCGGACCCATTAATACATATAATATTATCTTTCAATCTTTCTTAAGTTAGATTCGGACCCTACGGTCCGTGACTACTATACACTTTATGGGTAATTGTGTACATT
TTTATTCACAGGATCCGACGTTGGACTCCACATACGCGACGGAGCTAAAGAGGCGATGCCCGAATGGCGGCGGAAATGCGGTGGTGGACCTTGATTCGACAGCGAATCGTCTAGACAATC
GATATTTCGCCGATCTTAAGAGGTGGAGAGGGATTTTGAGCTCAGACCAGACACTTATGGATAGTACATTGACGAGGAATATAGCGACGAAGTTCGCAAGTGGGAATGGGGGCGCGTGGG
CTGGAAGGTACGCCAAGGCGATGGTGAAGATGGGGTCGATTGAGGTCCTTACGGGGAATCAAGGCGAGATTAGGAAAATTTGTAGTGTTGTCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTCACCCTCATCATCAACCACCATCACTACTCTTACTTCCCATCACATTACTAGTACTTCTCTTCATGTTCATGTCCATGTCCATGGCCGAGGCTTCTCTGAAGCCGGGCTTCTAC
AAGTCATCGTGCCCATCGGCTGAGGCCATCGTCAAGAGGGTCGTCACCAGGGCCGTGTCTCGTGATTCAAACCTTGGGGCCGGCATCATCAGGATGTACTTCCACGACTGCTTTATCAGG
GGATGTGACGGATCTGTCCTCCTGAAGTCCACTCCGGGAGGTAACCAAACCGAGAGAGACCATCCGGCCAACAACCCAAGCCTACGAGGATTCGAGGTAATCGACTCGGCCAAATTGGAA
CTCGAATCGGTCTGCCCAAACACTGTCTCCTGCGCCGACATTATCGCCTTCGCCGCTCGGGACAGCTCATTCGTCCTCGGACGCATCAACTACGCCGTCCCCGCCGGTCGGCCCGCCGGT
GGTCGTGCCGGCCGCTTCTCGTCTTTCGACGACATCGGTACGAACCTCCCGCCTCCGAGCTTCTCGGCAGAGCAATTGGCTCAGAATTTCGCCCGAAAGGGGTTGACCACTGAGGAGATG
GTGGTACTCTCCGGTGCCCACTCGATCGGTGTGGCCCACTGCTCGTCATTCGCTAATCGGCTCTACTCATTCAATGGGACCCACCCGCAG
GATCCGACGTTGGACTCCACATACGCGACG
GAGCTAAAGAGGCGATGCCCGAATGGCGGCGGAAATGCGGTGGTGGACCTTGATTCGACAGCGAATCGTCTAGACAATCGATATTTCGCCGATCTTAAGAGGTGGAGAGGGATTTTGAGC
TCAGACCAGACACTTATGGATAGTACATTGACGAGGAATATAGCGACGAAGTTCGCAAGTGGGAATGGGGGCGCGTGGGCTGGAAGGTACGCCAAGGCGATGGTGAAGATGGGGTCGATT
GAGGTCCTTACGGGGAATCAAGGCGAGATTAGGAAAATTTGTAGTGTTGTCAATTGA

Retrieve as FASTA