Entry information : LuPrx179(Lus10032511|PACid:23146332)
Entry ID 12119
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx179(Lus10032511|PACid:23146332)
Name LuPrx179(Lus10032511|PACid:23146332)
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx179
start..stop
S start..stop
LuPrx213 660 0 1..334 1..335
PtPrx88 464 3e-166 2..326 1..324
MePrx68 453 7e-162 24..325 25..325
RcPrx68 443 1e-157 23..326 24..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 519346..519570 225 N° 2 519661..519840 180 N° 3 519942..520107 166 N° 4 520718..521151 434
join(519346..519570,519661..519840,519942..520107,520718..521151)


exon

Literature and cross-references LuPrx179(Lus10032511|PACid:23146332)
DNA ref. Phytozome 12:   scaffold140 (519346..521151)
Protein sequence: LuPrx179(Lus10032511|PACid:23146332)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (308)
PWM (Da):   %s   35540.18 (32756.8) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.85 (7.12) Peptide Signal:   %s   cut: 27 range:27-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMTKETALAGFMLGLLLSGDPLICYGALQVGFYRGKCGFADVETIVGGVVSSHLFRDPTILASLIRLHFHDCFVNGCDASILLDGADTEKTASPNHSVRGYEIIDQAKAAVDKICPGVVSCADLIAIAARDAVFLSGGGIYRVQTGRKDGLVSSADIANVTLPGPSITVPQAVAAFADKGLTAVDMVLLLGAHSVGVAHCSFLDERIHNFRGSGRPDPSMDQFTVNTLRSRCPINSIENTVNLDQNPFSPFVLDNSYYQNILLRRGVLQIDQELGMNRFTRSIVANLAGAIDFPARFGAAMVRLGAVGVLTGTQGEVRRSCRVVNKVVSKDESG*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGACCAAGGAGACAGCACTTGCTGGGTTTATGTTGGGGCTGCTACTGTCAGGAGATCCGTTGATTTGCTATGGTGCACTCCAAGTAGGATTCTACAGAGGCAAATGTGGGTTCGCT
GATGTGGAAACCATCGTCGGAGGCGTCGTTTCGTCTCACCTCTTCAGAGACCCTACCATCCTCGCTTCCCTTATCCGACTCCATTTCCACGACTGTTTCGTCAAT
GTCTGTACCCTTACT
AGCCTCTTACTCTTCGCTTCCTTGGTTCATTTTCTCCATGTTTAATTTGTTGTTTATTTTTGTTCTCGATCCAAGGGCTGCGATGCGTCCATCCTTCTGGATGGTGCGGACACCGAGAAA
ACAGCTTCACCTAATCACAGCGTCAGAGGTTACGAGATTATCGACCAAGCTAAGGCCGCCGTCGACAAAATCTGTCCCGGTGTCGTTTCTTGTGCTGACCTCATCGCCATTGCCGCCCGC
GATGCAGTTTTCCTC
GTAACCTTCTTCTTCTTCTCCTTCATCTTCATCATAACTCAGACTTATTGTGCTGACCTTATTTAATACTTAGGCATTTCCCCCGATTTTTTTTGGAACAGAGTG
GAGGAGGGATATACAGAGTCCAAACTGGGAGAAAAGACGGGCTGGTTTCGTCTGCAGATATAGCAAACGTGACGCTTCCAGGGCCTTCCATTACCGTCCCGCAGGCCGTTGCTGCATTTG
CTGATAAGGGTCTCACCGCTGTTGACATGGTGCTCCTTCTAG
GTACGTACGTTCTTCGTGCTTGATTCGGAGTAAGAATTGACCGGATTTGGAGGCTAATTCCATATCAGAATAATTTCA
TGTTTTTTGCGATCATTAAGTGACATTTTTTATCCTGCTGGATTTGGTGGCTTAATTCCACCTAGTTCCAGCCTGTGAATTCCAGTTGCAGATGTATGGAATTATCAAGGCTTGAATTCG
AATTCCAAAGAATTTCGAAACTCCAGCCAGAATTAGACGCTCGGAAGTGGAAAACGCGGCCTTAGTAATTTCAATCGGGGTTATCCTTTGGCCTAAAGTAATTTCAGAACGGCCAGAATT
AGGCACGTACTAAGGTCGTGTTTTCCACGCTCGATTTGGAAGCGGAATTGGCGGGATTTGAGGGCCAATTCCAGAGGAGACATTTCTAATTACACTGGATTTGGCGCTTAATTCTACCTA
ATTCTAGTCCGCAAATTCTGTTTGGAGAGATACGGATTTGGCATTGAATCCAAAGCAATTGCGCTTAGAAGCGGAAAACGTGAACTAAGTAATTTAAAATTGGTGTATCCTATCGCTGCA
ATTTTTCCTTACTACCATTCAACTGACAAGTATTGATGCCAAACTGTAACAGGAGCTCATTCAGTTGGAGTAGCACACTGCTCTTTCCTGGACGAACGGATCCACAATTTCAGGGGCAGC
GGCAGACCCGACCCGTCAATGGACCAATTCACGGTCAATACCTTGAGATCAAGGTGCCCCATCAACTCAATCGAGAACACGGTCAACCTTGACCAGAATCCCTTCAGCCCGTTTGTGCTG
GACAATTCCTACTACCAGAACATACTGTTGCGGCGAGGGGTTCTCCAGATTGACCAGGAGCTTGGAATGAACAGATTCACCCGTTCAATAGTTGCGAATTTGGCCGGTGCGATCGATTTT
CCGGCTCGGTTTGGTGCGGCTATGGTCCGCCTAGGGGCTGTTGGTGTTCTTACGGGGACTCAGGGTGAGGTTAGGAGGTCTTGCAGAGTGGTTAACAAAGTTGTTAGCAAAGATGAATCT
GGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGACCAAGGAGACAGCACTTGCTGGGTTTATGTTGGGGCTGCTACTGTCAGGAGATCCGTTGATTTGCTATGGTGCACTCCAAGTAGGATTCTACAGAGGCAAATGTGGGTTCGCT
GATGTGGAAACCATCGTCGGAGGCGTCGTTTCGTCTCACCTCTTCAGAGACCCTACCATCCTCGCTTCCCTTATCCGACTCCATTTCCACGACTGTTTCGTCAAT
GGCTGCGATGCGTCC
ATCCTTCTGGATGGTGCGGACACCGAGAAAACAGCTTCACCTAATCACAGCGTCAGAGGTTACGAGATTATCGACCAAGCTAAGGCCGCCGTCGACAAAATCTGTCCCGGTGTCGTTTCT
TGTGCTGACCTCATCGCCATTGCCGCCCGCGATGCAGTTTTCCTC
AGTGGAGGAGGGATATACAGAGTCCAAACTGGGAGAAAAGACGGGCTGGTTTCGTCTGCAGATATAGCAAACGTG
ACGCTTCCAGGGCCTTCCATTACCGTCCCGCAGGCCGTTGCTGCATTTGCTGATAAGGGTCTCACCGCTGTTGACATGGTGCTCCTTCTAG
GAGCTCATTCAGTTGGAGTAGCACACTGC
TCTTTCCTGGACGAACGGATCCACAATTTCAGGGGCAGCGGCAGACCCGACCCGTCAATGGACCAATTCACGGTCAATACCTTGAGATCAAGGTGCCCCATCAACTCAATCGAGAACACG
GTCAACCTTGACCAGAATCCCTTCAGCCCGTTTGTGCTGGACAATTCCTACTACCAGAACATACTGTTGCGGCGAGGGGTTCTCCAGATTGACCAGGAGCTTGGAATGAACAGATTCACC
CGTTCAATAGTTGCGAATTTGGCCGGTGCGATCGATTTTCCGGCTCGGTTTGGTGCGGCTATGGTCCGCCTAGGGGCTGTTGGTGTTCTTACGGGGACTCAGGGTGAGGTTAGGAGGTCT
TGCAGAGTGGTTAACAAAGTTGTTAGCAAAGATGAATCTGGCTAG

Retrieve as FASTA