Entry information : LuPrx197(Lus10038055|PACid:23163775)
Entry ID 12130
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx197(Lus10038055|PACid:23163775)
Name LuPrx197(Lus10038055|PACid:23163775)
Class Class III peroxidase    [Orthogroup: Prx179]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx197
start..stop
S start..stop
LuPrx66 600 0 17..338 17..336
EcamPrx151 335 5e-115 10..337 5..323
EgrPrx154 333 1e-114 25..337 10..315
EgrPrx153 332 7e-114 25..337 10..315
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1058214..1058438 225 N° 2 1057284..1058075 792  
complement(join(1057284..1058075,1058214..1058438))


exon

Literature and cross-references LuPrx197(Lus10038055|PACid:23163775)
DNA ref. Phytozome 12:   scaffold475 (1058438..1057284)
Protein sequence: LuPrx197(Lus10038055|PACid:23163775)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (319)
PWM (Da):   %s   36267.47 (34168.3) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.06 (8.13) Peptide Signal:   %s   cut: 20 range:20-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSNISCLLLLLIAIISATTHVTPAAGGGTLEVGFYDSTCPSAERIVSRVVRKALSENPGLAPGIVRLHFHDFLVQGPDASILLDPVKGELEPVEKKAPAHDPGLRGFEVIDAAKSALEARCPGTVSCADILAFAARDSASHASSARNFTYKVPAGRRDGNISQASLVQQSLPPLSSDVDAIRQSFADKGLTLNETVALFGAHSFGTATCQFFSDRLYSFETNGTQGQDPSMNPGYARFLKSKCPKRGDGPGRRVNLDKVSPNTLDVQYYQNLVNRMGLLDSDQGLMSNATTAALVKEYAENARKWRRDFAAAMVKMGSLGVLTGDEGEIRKNCRLINK*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCAATATCAGCTGCCTGTTACTGCTTCTTATCGCCATTATTAGTGCAACTACTCATGTCACCCCCGCGGCAGGTGGCGGTACTCTGGAAGTAGGGTTCTATGACTCCACTTGTCCC
TCGGCCGAAAGGATCGTGAGCCGAGTGGTGAGAAAGGCACTTTCAGAAAACCCTGGGTTGGCTCCTGGGATCGTCCGCTTGCATTTCCATGATTTCCTTGTTCAG
GTAATTTGCGTATTG
ACATTTAGTACGTAGCAGTGTCTTGAACAATTGCGTCTCCCAATAACTCGAGCTCAGACTACTTGAGAGTGTCAAAAATCATCTATAAAAGCAATTTAATTGTTATGATTTTCTATGGTA
CAGGGTCCCGACGCTTCGATACTGCTCGATCCGGTCAAAGGCGAGCTGGAGCCAGTGGAGAAAAAGGCCCCTGCCCACGACCCAGGCCTGCGAGGCTTCGAGGTGATCGACGCCGCTAAA
TCTGCCCTGGAGGCTCGATGCCCTGGGACGGTCTCGTGCGCTGACATCCTGGCGTTCGCTGCACGCGATAGTGCCTCCCACGCATCCTCTGCAAGAAACTTCACCTACAAGGTTCCTGCA
GGGAGGCGCGATGGGAACATCTCCCAAGCATCGTTGGTCCAGCAAAGTCTCCCTCCACTTTCTAGCGACGTGGATGCCATCCGACAGAGTTTCGCTGACAAAGGCCTCACGTTGAATGAG
ACGGTGGCGCTATTTGGGGCCCACTCCTTCGGAACTGCCACGTGTCAGTTCTTCTCTGACCGGTTATACTCCTTCGAGACGAACGGGACCCAGGGGCAAGACCCGTCAATGAATCCGGGC
TATGCCCGGTTTCTAAAGTCCAAGTGCCCTAAACGGGGAGATGGGCCGGGCCGTAGGGTGAATCTAGATAAGGTGAGCCCAAATACCCTTGACGTTCAGTATTACCAAAACTTGGTGAAC
AGGATGGGGCTGTTGGACTCTGATCAAGGGCTGATGAGCAATGCTACCACGGCAGCTCTCGTAAAGGAGTACGCCGAAAATGCGAGGAAGTGGCGGAGGGATTTCGCAGCGGCGATGGTG
AAAATGGGAAGCCTCGGTGTGTTGACTGGGGATGAAGGCGAGATCAGGAAGAACTGTCGCCTTATTAATAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCAATATCAGCTGCCTGTTACTGCTTCTTATCGCCATTATTAGTGCAACTACTCATGTCACCCCCGCGGCAGGTGGCGGTACTCTGGAAGTAGGGTTCTATGACTCCACTTGTCCC
TCGGCCGAAAGGATCGTGAGCCGAGTGGTGAGAAAGGCACTTTCAGAAAACCCTGGGTTGGCTCCTGGGATCGTCCGCTTGCATTTCCATGATTTCCTTGTTCAG
GGTCCCGACGCTTCG
ATACTGCTCGATCCGGTCAAAGGCGAGCTGGAGCCAGTGGAGAAAAAGGCCCCTGCCCACGACCCAGGCCTGCGAGGCTTCGAGGTGATCGACGCCGCTAAATCTGCCCTGGAGGCTCGA
TGCCCTGGGACGGTCTCGTGCGCTGACATCCTGGCGTTCGCTGCACGCGATAGTGCCTCCCACGCATCCTCTGCAAGAAACTTCACCTACAAGGTTCCTGCAGGGAGGCGCGATGGGAAC
ATCTCCCAAGCATCGTTGGTCCAGCAAAGTCTCCCTCCACTTTCTAGCGACGTGGATGCCATCCGACAGAGTTTCGCTGACAAAGGCCTCACGTTGAATGAGACGGTGGCGCTATTTGGG
GCCCACTCCTTCGGAACTGCCACGTGTCAGTTCTTCTCTGACCGGTTATACTCCTTCGAGACGAACGGGACCCAGGGGCAAGACCCGTCAATGAATCCGGGCTATGCCCGGTTTCTAAAG
TCCAAGTGCCCTAAACGGGGAGATGGGCCGGGCCGTAGGGTGAATCTAGATAAGGTGAGCCCAAATACCCTTGACGTTCAGTATTACCAAAACTTGGTGAACAGGATGGGGCTGTTGGAC
TCTGATCAAGGGCTGATGAGCAATGCTACCACGGCAGCTCTCGTAAAGGAGTACGCCGAAAATGCGAGGAAGTGGCGGAGGGATTTCGCAGCGGCGATGGTGAAAATGGGAAGCCTCGGT
GTGTTGACTGGGGATGAAGGCGAGATCAGGAAGAACTGTCGCCTTATTAATAAATAA

Retrieve as FASTA