Entry information : LuPrx198(Lus10038393|PACid:23158196)
Entry ID 12131
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx198(Lus10038393|PACid:23158196)
Name LuPrx198(Lus10038393|PACid:23158196)
Class Class III peroxidase    [Orthogroup: Prx037]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx198
start..stop
S start..stop
LuPrx12 647 0 1..345 1..345
MePrx118 472 1e-168 6..342 7..344
PtPrx62 453 2e-160 21..342 76..398
PpePrx71 448 3e-159 31..342 39..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1080316..1080600 285 N° 2 1080863..1081205 343 N° 3 1081574..1081983 410  
join(1080316..1080600,1080863..1081205,1081574..1081983)


exon

Literature and cross-references LuPrx198(Lus10038393|PACid:23158196)
DNA ref. Phytozome 12:   scaffold28 (1080316..1081983)
Protein sequence: LuPrx198(Lus10038393|PACid:23158196)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (327)
PWM (Da):   %s   38410.92 (36126.8)  
PI (pH):   %s   5.75 (5.11) Peptide Signal:   %s   cut: 19 range:19-345
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTFVFIFAILCFRSAFAGVNFDENNNNDEAITLQVSTLLDTSSSDNDLLSFAYYQGTCPEAEGIINRKVRDWAKKDPTLAASLMRLHFHDCAVRGCDASILLSNVGSERTAHASKTLRGFEVIDDIKKELESKCPKTVSCADILTADSRDATVILGGPYWSIPYGRKDGKVSTEKEAELVPMGRENITALIQFYQSKGLNVLDLVALSGAHTVGRASCGEIQDRIYDYKGSGKSDSTMDKKYSNYLTRKCRWGSDYVELDAITPDKFDNQYYKNLQRKMGLLRTDQAMYADSRTSPFVNALAYAPPSVFYNQFAASMAKLGNVVEDVDDGEVRTNCNYVNSVHY*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGACCTTCGTTTTCATCTTCGCCATTCTTTGCTTCCGATCGGCTTTTGCTGGTGTTAACTTCGACGAAAACAACAACAACGACGAAGCAATAACACTACAAGTGTCGACATTGCTC
GACACTTCGTCGTCTGACAACGATTTGCTGTCGTTTGCCTATTACCAAGGCACTTGCCCCGAAGCTGAAGGCATCATCAACCGTAAAGTTCGCGATTGGGCCAAGAAGGATCCGACTCTC
GCTGCTAGCCTCATGCGCCTCCACTTTCACGACTGTGCCGTTAGG
GTAATTACTAATTAGCACCAAACATTGTTTTTACTTCACTTTTTTTTATGGTGGCTTAAATTCGTCCACTCTTAA
TTTTGCCATTACAGATATTTACAATTGGATTTATAAATAAAAAATATTATTACTGGCGTGTTGTTATAATTTTTTTAAAAGAATGCTGCATTTGAGGTGAATGGTATAATTTAATTGTAC
AATTAGTTTGTCCTAAATATTAAAAAAAAATCAATTCCAAAATTTCTGCTTATGAACTTATTTGCAGGGTTGTGATGCTTCAATTCTACTGAGCAACGTAGGAAGCGAGAGGACAGCACA
CGCCAGCAAGACCCTACGTGGGTTTGAAGTGATTGACGACATCAAGAAGGAACTCGAAAGCAAATGCCCCAAAACGGTGTCGTGCGCTGACATTCTTACCGCAGACTCACGGGACGCCAC
TGTTATTCTGGGAGGTCCATACTGGTCAATCCCCTACGGGAGAAAAGACGGGAAAGTTTCGACTGAAAAAGAAGCCGAATTGGTGCCGATGGGTCGCGAAAACATTACCGCTCTCATCCA
GTTCTACCAGTCTAAAGGCCTCAACGTGCTTGATCTTGTCGCTCTCTCAG
GTACTAGGCATTTTGTTGATTCGATAGTTCTCGTTTAATCATCGTTAGAGTGCAACAGTTTCCTCTATGA
TTTATGTCAAATATGTCATGTCACATAAACATGCCATGTCGTCAAATTGATCAATATGCGACGTCGAACTTATGTCAATCATTGTAACGTGATGATATGTTTGATGTCACATAATGGTCA
CTTATTCTTCACGACATGATGACACAATTTTATTTGACTTGGAATATTATAGTTACCACATTTTCAATTACATGGTATGTTGACGTGACATATTTGACCAAAATCGTTGCAAAGTTGAGA
TTCATTAAACAAAAGCAATCCTTACCAGCTCAGGATTTGTTGCGTGTACATTTTACAGGAGCGCATACCGTTGGTCGGGCGAGCTGCGGGGAGATTCAAGACAGGATCTACGACTACAAG
GGAAGTGGAAAATCAGATTCAACGATGGACAAGAAATACTCAAACTATCTTACCAGGAAATGCAGGTGGGGTTCGGACTACGTTGAGCTTGATGCCATAACGCCAGACAAGTTCGACAAC
CAGTACTACAAGAATCTACAGAGGAAGATGGGACTTTTGCGGACTGATCAAGCCATGTACGCCGATTCCAGGACTTCCCCCTTCGTTAACGCGTTGGCTTACGCTCCACCTTCTGTGTTC
TACAACCAGTTCGCTGCGTCGATGGCCAAGCTTGGCAATGTAGTTGAGGACGTGGATGATGGCGAGGTGCGGACCAACTGCAATTATGTCAACTCTGTCCATTACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGACCTTCGTTTTCATCTTCGCCATTCTTTGCTTCCGATCGGCTTTTGCTGGTGTTAACTTCGACGAAAACAACAACAACGACGAAGCAATAACACTACAAGTGTCGACATTGCTC
GACACTTCGTCGTCTGACAACGATTTGCTGTCGTTTGCCTATTACCAAGGCACTTGCCCCGAAGCTGAAGGCATCATCAACCGTAAAGTTCGCGATTGGGCCAAGAAGGATCCGACTCTC
GCTGCTAGCCTCATGCGCCTCCACTTTCACGACTGTGCCGTTAGG
GGTTGTGATGCTTCAATTCTACTGAGCAACGTAGGAAGCGAGAGGACAGCACACGCCAGCAAGACCCTACGTGGG
TTTGAAGTGATTGACGACATCAAGAAGGAACTCGAAAGCAAATGCCCCAAAACGGTGTCGTGCGCTGACATTCTTACCGCAGACTCACGGGACGCCACTGTTATTCTGGGAGGTCCATAC
TGGTCAATCCCCTACGGGAGAAAAGACGGGAAAGTTTCGACTGAAAAAGAAGCCGAATTGGTGCCGATGGGTCGCGAAAACATTACCGCTCTCATCCAGTTCTACCAGTCTAAAGGCCTC
AACGTGCTTGATCTTGTCGCTCTCTCAG
GAGCGCATACCGTTGGTCGGGCGAGCTGCGGGGAGATTCAAGACAGGATCTACGACTACAAGGGAAGTGGAAAATCAGATTCAACGATGGAC
AAGAAATACTCAAACTATCTTACCAGGAAATGCAGGTGGGGTTCGGACTACGTTGAGCTTGATGCCATAACGCCAGACAAGTTCGACAACCAGTACTACAAGAATCTACAGAGGAAGATG
GGACTTTTGCGGACTGATCAAGCCATGTACGCCGATTCCAGGACTTCCCCCTTCGTTAACGCGTTGGCTTACGCTCCACCTTCTGTGTTCTACAACCAGTTCGCTGCGTCGATGGCCAAG
CTTGGCAATGTAGTTGAGGACGTGGATGATGGCGAGGTGCGGACCAACTGCAATTATGTCAACTCTGTCCATTACTGA

Retrieve as FASTA