Entry information : LuPrx205(Lus10040107|PACid:23173832)
Entry ID 12137
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx205(Lus10040107|PACid:23173832)
Name LuPrx205(Lus10040107|PACid:23173832)
Class Class III peroxidase    [Orthogroup: Prx046]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx205
start..stop
S start..stop
PtPrx83 418 4e-148 9..312 32..338
GmPrx105 405 4e-143 2..312 17..332
PpePrx23 395 3e-139 11..312 26..333
MtPrx90 392 1e-137 11..311 26..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 179726..179893 168 N° 2 179425..179616 192 N° 3 178483..178648 166 N° 4 177960..178375 416
complement(join(177960..178375,178483..178648,179425..179616,179726..179893))


exon

Literature and cross-references LuPrx205(Lus10040107|PACid:23173832)
DNA ref. Phytozome 12:   scaffold86 (179893..177960)
Protein sequence: LuPrx205(Lus10040107|PACid:23173832)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314
PWM (Da):   %s   34591.44  
PI (pH):   %s   7.43
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACSICQGQNLVQHYYKGTCPSAEAIVRYNVEDAVIKHPRIAASLIRLHFHDCFVMGCDGSLLLDRKGGMQSEKDAKPNANSVHGFELVDKIKSEVEQACPSTVSCADILAIAARDAVALRGGKGWEVMLGRKDSLNASIDAANDLLPSPNSTVKELVDNFKQQGLDIKDLVALSGAHTLGKARCSSINGRIHDLFESRKNDEYERHTTFLKILRSTCLGNQRQLAPLDLQTPFRFDNKYYLNILQGRGLLGSDDVLVSERNTTVMSLVWAYASNEELFFRDFAKSMIEMGNINVLTGNQGEIRKNCRVVNSS*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction. Extra 5'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTTCGATTTGCCAAGGACAGAATCTGGTACAACACTACTACAAGGGAACATGCCCTTCAGCAGAAGCTATTGTTAGGTACAATGTTGAGGATGCTGTAATCAAGCATCCTCGA
ATCGCGGCTTCCCTAATCCGCCTCCATTTTCATGACTGCTTTGTCATG
GTAAATTAAAGAGTTTGGTTTGCACAAGTACTTTTGTAGCTGCAGCTATAGGTGTTTCATATGATATGATAA
AGTTGTGAACTTTTCTATGCTTGGGAAATATATACAGGGTTGTGATGGATCTTTGCTCCTGGATAGAAAAGGGGGAATGCAGAGTGAGAAGGATGCGAAACCAAACGCAAACTCGGTGCA
TGGATTTGAGTTGGTTGATAAGATAAAGAGTGAAGTGGAACAAGCTTGCCCTTCTACTGTCTCTTGTGCCGATATATTGGCCATTGCTGCTCGCGATGCTGTTGCTTTG
GTAATTAATTA
AAACTCCCCTTCTTCTCCTACCTAGCGTTATTTATTAGGTGATATATGTTGCACTTTGGAATAACATTTGTAGAAAAATAAAGTTCTATAGATAATGTAGAATAATATTATGCATGCAGC
ATGTTATGATTAGCTCCAAGTGTTGGATTAAACAAAGAAGTTAAATGATTAATTAAAGGGAAAATATACATTTATACCTTTGTACTATGCAAAATTTATATCGGTATCTTTTTATTAAAT
TTTAATTGATTAATCTTTTTGAATTTTGACGGTTTTAATAAATACACCCTTTTGTTAGTTTGTCATCCAAAATTTGTTTAGTAAACTGATTATACACGACATATAAGTTTAGCCGTCTAC
TTGACCGAATATTTGCTGACGGGGAATTCCACTAAAGTTAAAACAATTTTTTTTGGTAAACTCAAAATAATTAGAACCCTAAAATTCAAAATTCAAAACTAAGCAAAACTTTCAATCAGT
TTCATTCTACCTAAAAAGGAATTTTGAGTTTAGTGGAATAACGATCATTAAATAATTCTGTCATATAGACGGAAAAGTTTATGTGGCATGTACAATCAACATACTAAACAGAATTTGGAT
GGAAAAACTAACAGAATAGTGCGTTGGTTAAAACAGTCAAAGCTTAGGGGTTTCATCGGTTAAAATTTAATAGAGGAGTAAATTTTACATAGTACAGTGATGTAAATGTATTTCCCCTAA
AATCTGTCTTCTTCCTTAATTAATTAATTTAATTATTATGGAAAGAGAGGAGGGAAGGGATGGGAAGTGATGCTGGGGAGAAAGGACTCACTGAATGCAAGCATTGATGCTGCCAATGAC
TTGTTGCCTTCTCCCAATTCTACCGTTAAGGAACTTGTAGATAACTTCAAGCAACAGGGTCTTGACATCAAAGATTTGGTTGCTTTATCAG
GTAACCAGTTTGTTGCCCGCTCGATGTGC
GGTGATTGTTTTGGTATATTATCAAACATGATGTAGCGGCCTATTGGACATATACATGGCGTTACCTGTTTCTAATAGGTGCACATACGTTGGGGAAGGCAAGATGCTCGAGCATCAACG
GAAGGATCCATGATCTCTTTGAATCGAGGAAGAACGACGAGTACGAGAGGCACACTACATTCTTAAAAATCCTAAGGTCAACATGCCTAGGAAATCAACGCCAACTAGCTCCCCTTGATT
TACAGACACCTTTCAGATTCGACAACAAGTACTATCTCAACATCCTCCAAGGCAGAGGCTTGTTGGGCTCCGACGATGTCCTAGTCTCCGAAAGAAACACCACGGTCATGAGCTTGGTAT
GGGCGTATGCGTCGAACGAGGAGCTCTTCTTTCGAGATTTCGCAAAGTCAATGATCGAGATGGGAAACATCAATGTGCTCACCGGTAATCAAGGTGAAATCCGGAAGAATTGTAGGGTTG
TTAACTCTTCATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTTCGATTTGCCAAGGACAGAATCTGGTACAACACTACTACAAGGGAACATGCCCTTCAGCAGAAGCTATTGTTAGGTACAATGTTGAGGATGCTGTAATCAAGCATCCTCGA
ATCGCGGCTTCCCTAATCCGCCTCCATTTTCATGACTGCTTTGTCATG
GGTTGTGATGGATCTTTGCTCCTGGATAGAAAAGGGGGAATGCAGAGTGAGAAGGATGCGAAACCAAACGCA
AACTCGGTGCATGGATTTGAGTTGGTTGATAAGATAAAGAGTGAAGTGGAACAAGCTTGCCCTTCTACTGTCTCTTGTGCCGATATATTGGCCATTGCTGCTCGCGATGCTGTTGCTTTG
AGAGGAGGGAAGGGATGGGAAGTGATGCTGGGGAGAAAGGACTCACTGAATGCAAGCATTGATGCTGCCAATGACTTGTTGCCTTCTCCCAATTCTACCGTTAAGGAACTTGTAGATAAC
TTCAAGCAACAGGGTCTTGACATCAAAGATTTGGTTGCTTTATCAG
GTGCACATACGTTGGGGAAGGCAAGATGCTCGAGCATCAACGGAAGGATCCATGATCTCTTTGAATCGAGGAAG
AACGACGAGTACGAGAGGCACACTACATTCTTAAAAATCCTAAGGTCAACATGCCTAGGAAATCAACGCCAACTAGCTCCCCTTGATTTACAGACACCTTTCAGATTCGACAACAAGTAC
TATCTCAACATCCTCCAAGGCAGAGGCTTGTTGGGCTCCGACGATGTCCTAGTCTCCGAAAGAAACACCACGGTCATGAGCTTGGTATGGGCGTATGCGTCGAACGAGGAGCTCTTCTTT
CGAGATTTCGCAAAGTCAATGATCGAGATGGGAAACATCAATGTGCTCACCGGTAATCAAGGTGAAATCCGGAAGAATTGTAGGGTTGTTAACTCTTCATAG

Retrieve as FASTA