Entry information : LuPrx26(Lus10004859|PACid:23157153)
Entry ID 12147
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx26(Lus10004859|PACid:23157153)
Name LuPrx26(Lus10004859|PACid:23157153)
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx26
start..stop
S start..stop
MePrx79 418 7e-148 12..315 24..323
PpePrx68 409 2e-144 1..317 12..327
CclPrx109 404 9e-143 1..316 13..324
HaPrx24 389 9e-137 1..316 11..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45954..46151 198 N° 2 45179..45361 183 N° 3 44935..45094 160 N° 4 44432..44844 413
complement(join(44432..44844,44935..45094,45179..45361,45954..46151))


exon

Literature and cross-references LuPrx26(Lus10004859|PACid:23157153)
DNA ref. Phytozome 12:   scaffold1821 (46151..44432)
Protein sequence: LuPrx26(Lus10004859|PACid:23157153)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (302)
PWM (Da):   %s   34063.33 (32469.4)  
PI (pH):   %s   8.56 (8.56) Peptide Signal:   %s   cut: 16 range:16-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGLLLLGLAADKAQAQLQFGFYKGKCRATNVDVESTVRSIVSEKYQSDKSIVAALLRMQFHDCFVQGCDASILLDGTTSEKTAPPNLSVRGYEIIDAVKTALEGSCGPQVVSCADIIVMATRDAVSLAKGGFYNVQTGRRDGLVSQAKNVALPAPNVPIPQAIGMFARKNLSPIDMVYLLGGHTVGVSHCAFFQDRLYNFKNTGRPDPSMNTTLLNSLRQTCPPNSNSANTTNLDQNPTSSLVVDNSYYQQLLRRNGILQVDQDLASNPLTGFIVSAIASRADFSARFGQAMVNLGAVDVLTGQQGQIRKSCRAVNK*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCTCTTATTGTTGGGCCTAGCAGCGGACAAGGCCCAAGCCCAGCTCCAGTTCGGGTTCTACAAGGGGAAATGCAGAGCCACCAACGTGGACGTGGAGTCCACCGTCCGGAGCATC
GTGTCGGAGAAGTACCAGTCCGACAAGTCCATCGTCGCTGCTCTGCTCCGCATGCAGTTCCACGACTGCTTTGTCCAA
GTAAACAATTTTTATTCATATTTATAAATTAAGAGTGGGAAA
CCGGGCACACCGTTTATTTGGTTGGACCGAAATTGATCATTGACTGGTCGAAACCGGTTTCAATCATTCGAAAACCGGCTGCAGTAGTAGGTTTGGATCCATGTGCAGTTTTAACTCAGT
TCCTTCATGATTTCCAAATAAATTGTGAATCAATACTTAATTGTCTAAATCCACAAATTAAATATCCAAACCAACTATTTTGTATTAACCGAACCGAGAGTCTCGGTCAATTCTGAAAAA
TGTCCAAACCCATATATTATCTCAATCTTTTTTCAAAATCGATAAAAATTCTGGCCAAAACTACTCAAATTTGTCATAATTCGGTGAAATTCGGTGGGCCGTAACCAAATTCAATCCGGT
AACGGTCACGATCACGAGTTTTGGTTGATTTCGGTCATGGCCACATATCGAATTTGGTTCAGTTTTAACAATGATTGACCGAATTACCACCGTTACCTATATTCATTTAGACCCATTTTA
GTTATTTGTATCGAAACTTTGAAAGTAATTTTTTTTAATAACACATTTATTTTGTTTGCGTTATTTATAGGGTTGTGATGCATCGATACTCCTAGACGGGACAACCAGCGAGAAGACTGC
GCCGCCGAATCTAAGTGTGAGGGGCTACGAGATCATAGACGCGGTGAAGACTGCACTAGAAGGGTCATGTGGACCGCAAGTCGTTTCTTGCGCTGACATCATCGTCATGGCTACTAGGGA
TGCTGTATCACTG
GTGATTATTCTTGGGCATCCTCCTAAATCATGTTTAGCATATTGATCGACTAAGTGAGATTAACGATTGTGTTCGGCTTTATAGGCGAAAGGCGGGTTTTACAACGT
GCAAACCGGGAGGAGGGACGGGTTGGTGTCACAAGCTAAAAATGTAGCTCTTCCGGCTCCGAATGTCCCGATCCCTCAAGCCATTGGCATGTTTGCTAGGAAGAACCTCTCCCCAATTGA
CATGGTTTATCTTCTCG
GTGCGTACACGATCTTGAAAACCGATCAATTCGGAACGTTCAATTTTTCGAAATGGTTAACTCATACATGTTATGTAATCTTTTTGGTAGGAGGACACACGGT
TGGTGTATCACACTGTGCATTTTTCCAAGACCGTCTGTACAACTTTAAAAACACGGGACGACCCGACCCGAGCATGAACACAACCCTACTCAACTCCCTCAGGCAGACTTGCCCACCCAA
CTCGAACTCGGCCAACACCACGAACTTGGACCAGAACCCGACCAGCTCTCTCGTGGTCGACAATTCCTACTACCAGCAACTCTTGAGACGTAATGGTATACTCCAGGTCGACCAAGACCT
GGCTTCCAACCCTCTTACCGGGTTCATTGTGTCGGCAATCGCGAGTCGGGCTGATTTCTCGGCCCGGTTTGGGCAGGCCATGGTCAACTTGGGTGCTGTGGATGTGCTCACTGGTCAGCA
AGGGCAGATCAGGAAGTCTTGCCGGGCTGTTAACAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTCTCTTATTGTTGGGCCTAGCAGCGGACAAGGCCCAAGCCCAGCTCCAGTTCGGGTTCTACAAGGGGAAATGCAGAGCCACCAACGTGGACGTGGAGTCCACCGTCCGGAGCATC
GTGTCGGAGAAGTACCAGTCCGACAAGTCCATCGTCGCTGCTCTGCTCCGCATGCAGTTCCACGACTGCTTTGTCCAA
GGTTGTGATGCATCGATACTCCTAGACGGGACAACCAGCGAG
AAGACTGCGCCGCCGAATCTAAGTGTGAGGGGCTACGAGATCATAGACGCGGTGAAGACTGCACTAGAAGGGTCATGTGGACCGCAAGTCGTTTCTTGCGCTGACATCATCGTCATGGCT
ACTAGGGATGCTGTATCACTG
GCGAAAGGCGGGTTTTACAACGTGCAAACCGGGAGGAGGGACGGGTTGGTGTCACAAGCTAAAAATGTAGCTCTTCCGGCTCCGAATGTCCCGATCCCT
CAAGCCATTGGCATGTTTGCTAGGAAGAACCTCTCCCCAATTGACATGGTTTATCTTCTCG
GAGGACACACGGTTGGTGTATCACACTGTGCATTTTTCCAAGACCGTCTGTACAACTTT
AAAAACACGGGACGACCCGACCCGAGCATGAACACAACCCTACTCAACTCCCTCAGGCAGACTTGCCCACCCAACTCGAACTCGGCCAACACCACGAACTTGGACCAGAACCCGACCAGC
TCTCTCGTGGTCGACAATTCCTACTACCAGCAACTCTTGAGACGTAATGGTATACTCCAGGTCGACCAAGACCTGGCTTCCAACCCTCTTACCGGGTTCATTGTGTCGGCAATCGCGAGT
CGGGCTGATTTCTCGGCCCGGTTTGGGCAGGCCATGGTCAACTTGGGTGCTGTGGATGTGCTCACTGGTCAGCAAGGGCAGATCAGGAAGTCTTGCCGGGCTGTTAACAAATAA

Retrieve as FASTA