Entry information : LuPrx27(Lus10005278|PACid:23175320)
Entry ID 12148
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-30 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx27(Lus10005278|PACid:23175320)
Name LuPrx27(Lus10005278|PACid:23175320)
Class Class III peroxidase    [Orthogroup: Prx026]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx27
start..stop
S start..stop
LuPrx78 650 0 1..344 1..344
RcPrx49 503 1e-180 11..342 16..351
CppPrx08 500 1e-179 16..342 22..352
MePrx10 499 2e-179 11..342 18..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 87733..87987 255 N° 2 88058..88258 201 N° 3 89105..89683 579  
join(87733..87987,88058..88258,89105..89683)


exon

Literature and cross-references LuPrx27(Lus10005278|PACid:23175320)
DNA ref. Phytozome 12:   scaffold109 (87733..89683)
Protein sequence: LuPrx27(Lus10005278|PACid:23175320)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344 (314)
PWM (Da):   %s   37810.37 (34636.6) Transmb domain:   %s   o10-32i
PI (pH):   %s   9.57 (9.60) Peptide Signal:   %s   cut: 31 range:31-344
Sequence 385
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAILPHSPSTFLYISLIILLLLHISSATGAATNRRRPRQLSVNYYARTCPHLEQLVGSVTSQQFKVSPVSGAATIRLFFHDCFVQGCDGSILMSTKPGSRELAEKEAEDNKDLRAEGYDTVFKAKSLVETKCPGAVSCSDILAIAARDYVHLTGGPYYQVKKGRFDGKTSKATTVPGNIPRPNSTVDALFTLFRTKGLSLQDMVVLSGAHTIGFAHCKQFVSRLYDYKGTKNPDPTLDPRLLKELRMSCPRVGSNDGVVVPFDVTTPFMFDHAYYLNLEGRLGLLGSDQGLWMDPRTKGVVQEMGRDRGKFLGMFGLAMEKMGDIGVKRGRRHGEIRKDCSMVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction. Extra 3'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAATTCTGCCACACTCTCCATCCACTTTCCTCTACATTTCTCTTATCATTCTTCTTCTTCTTCACATTTCCTCAGCCACCGGCGCAGCCACTAACCGCCGTCGGCCACGTCAGCTCT
CCGTCAACTACTACGCCAGGACATGTCCACATCTTGAGCAGCTCGTCGGCTCAGTCACTTCCCAGCAGTTCAAGGTGTCTCCCGTTTCCGGTGCAGCCACCATCCGCCTCTTCTTCCACG
ACTGCTTCGTCCAG
GTAGGTGATTCTTCAGATCGAATTCATGTCGACTAGCTGTATTGCTGCTCTAACTCTCTTTTTTTTTAAGGGCTGTGACGGGTCAATTCTGATGTCGACGAAGCCA
GGAAGCAGAGAATTGGCAGAGAAGGAAGCAGAGGATAATAAGGACCTGAGAGCAGAAGGATACGACACCGTTTTCAAAGCCAAGTCCCTCGTTGAAACCAAGTGCCCCGGCGCCGTCTCT
TGCTCCGACATCCTCGCCATTGCCGCCCGTGACTATGTCCACTTA
GTAAGTCTGTCTCCCCCTTTGACCTTTCTCTGAATTATCCAAATCTCCAAAACCGAACCAGTCAAACAAGGTGAC
ACTCTAATTAATCCGGTATGTTATTTTTAGTTTAAATCAACTTTAAACGGTTATGTGCGAATACATATAGAATATTAATTTCTATGGACGTAGTTTTATAGGGATATTTTGTAGGTTAAT
AATAGTTAATTATTTCAATTGTCTTAGTTAGAATATTAAAAATTTCGAGTTAGATAATTTGAAATAGTTTCTAGTGATTTTGAATTTTTCTTCTTTAAAATGCTGAACTCTAGTTGGCGG
TTTTAATTGAAAATCTACCGAGTATTGGTATGCTATGAGTTTTATTATCTGAATTTTTTTATTATTATAAATGATAAAGAAAGTAATTCCAACAAAAAAAGTGCAAATCTCAAAAATTAA
AATCATTGTCTACATAAGTCCCCATCCACACAAAAAATTGGCAAGTGCAGCTAAAATCAACAATGAGTATCCGAAATTTTTTTAAAATGATTATTATCAAAACTTAAAATAGATGACGAA
TAAATACCAACTATTCAAACCTGAACAATCACATTGCTAAGCATACTCCAAATATCATTTCATTTTTAGTAACAAGTAAATTATATCCATGAGGCCATGACCACTCAACTGTTACTTTTA
TTAAATATTTAACTATTGATAAGTGATACATGTTCATTAAATGTTGGGATAGGTAACATTTTGTTGACTTTTGATTTTTATTTTATAACGATCTTTTACTTAAATTTCTAGGTAGTAATC
ATATTAAACCGATTCATCTCAATTATTTGTACCTTTATTTGAATGGGTTAGACAGGTGGACCATACTACCAAGTGAAGAAAGGTAGATTTGACGGGAAAACATCCAAGGCAACAACAGTA
CCCGGCAACATTCCACGGCCAAATTCGACCGTCGATGCCCTCTTTACACTCTTCCGAACCAAAGGCCTATCGTTGCAAGACATGGTGGTCCTGTCCGGAGCACACACGATCGGATTTGCG
CACTGCAAGCAATTCGTCAGCAGGCTGTACGACTACAAGGGCACAAAAAACCCTGACCCAACCCTGGACCCAAGGCTATTGAAGGAACTGAGGATGTCGTGCCCACGGGTCGGGTCGAAC
GACGGGGTAGTGGTTCCGTTCGATGTTACGACGCCGTTTATGTTTGATCACGCTTACTACTTGAACTTGGAAGGAAGATTGGGCCTACTGGGCTCGGATCAGGGCCTGTGGATGGATCCC
AGGACCAAGGGTGTGGTCCAGGAGATGGGGAGGGATAGAGGCAAGTTTCTTGGGATGTTTGGTTTGGCTATGGAGAAGATGGGGGATATTGGTGTTAAGAGAGGGAGGAGACATGGTGAG
ATTAGGAAAGATTGTAGTATGGTTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAATTCTGCCACACTCTCCATCCACTTTCCTCTACATTTCTCTTATCATTCTTCTTCTTCTTCACATTTCCTCAGCCACCGGCGCAGCCACTAACCGCCGTCGGCCACGTCAGCTCT
CCGTCAACTACTACGCCAGGACATGTCCACATCTTGAGCAGCTCGTCGGCTCAGTCACTTCCCAGCAGTTCAAGGTGTCTCCCGTTTCCGGTGCAGCCACCATCCGCCTCTTCTTCCACG
ACTGCTTCGTCCAG
GGCTGTGACGGGTCAATTCTGATGTCGACGAAGCCAGGAAGCAGAGAATTGGCAGAGAAGGAAGCAGAGGATAATAAGGACCTGAGAGCAGAAGGATACGACACCG
TTTTCAAAGCCAAGTCCCTCGTTGAAACCAAGTGCCCCGGCGCCGTCTCTTGCTCCGACATCCTCGCCATTGCCGCCCGTGACTATGTCCACTTA
ACAGGTGGACCATACTACCAAGTGA
AGAAAGGTAGATTTGACGGGAAAACATCCAAGGCAACAACAGTACCCGGCAACATTCCACGGCCAAATTCGACCGTCGATGCCCTCTTTACACTCTTCCGAACCAAAGGCCTATCGTTGC
AAGACATGGTGGTCCTGTCCGGAGCACACACGATCGGATTTGCGCACTGCAAGCAATTCGTCAGCAGGCTGTACGACTACAAGGGCACAAAAAACCCTGACCCAACCCTGGACCCAAGGC
TATTGAAGGAACTGAGGATGTCGTGCCCACGGGTCGGGTCGAACGACGGGGTAGTGGTTCCGTTCGATGTTACGACGCCGTTTATGTTTGATCACGCTTACTACTTGAACTTGGAAGGAA
GATTGGGCCTACTGGGCTCGGATCAGGGCCTGTGGATGGATCCCAGGACCAAGGGTGTGGTCCAGGAGATGGGGAGGGATAGAGGCAAGTTTCTTGGGATGTTTGGTTTGGCTATGGAGA
AGATGGGGGATATTGGTGTTAAGAGAGGGAGGAGACATGGTGAGATTAGGAAAGATTGTAGTATGGTTAATTGA

Retrieve as FASTA