Entry information : LuPrx32(Lus10006535|PACid:23149169)
Entry ID 12152
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx32(Lus10006535|PACid:23149169)
Name LuPrx32(Lus10006535|PACid:23149169)
Class Class III peroxidase     [Orthogroup: Prx018]*
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx32
start..stop
S start..stop
LuPrx31 350 7e-121 1..193 1..194
LuPrx07 352 2e-120 1..193 1..194
LuPrx07 102 1e-24 227..294 332..399
GmPrx89 288 1e-96 1..193 1..192
NnPrx53 287 3e-96 10..193 9..191
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7064..7282 219 N° 2 7385..7576 192 N° 3 7813..8080 268 N° 4 9582..9940 359
join(7064..7282,7385..7576,7813..8080,9582..9940)


exon

Literature and cross-references LuPrx32(Lus10006535|PACid:23149169)
DNA ref. Phytozome 12:   scaffold1202 (7064..9940)
Protein sequence: LuPrx32(Lus10006535|PACid:23149169)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (324)
PWM (Da):   %s   37299.32 (34909.1)  
PI (pH):   %s   8.65 (8.49) Peptide Signal:   %s   cut: 22 range:22-345
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYSFAKSSFVTLFIIVSVLAATSNAQLAGNFYARTCPNVQGIVRGAMREAVNREPRLGASILRLFFHDCFVNGCDGSILLDDTSTFTGEKNAIPNRNSARGFEVIDTIKTRVERACSATVSCADILAIAARDGVVLLGGPSWQVLLGRRDARTASQSDANNDLPSPFSDLPALISSFTNKGLTAADMTVLSGCPIRQCLLQGACGPAWATALRPAAVQRWVPRCFDDFSFNGLNVPRTISSNKVGSNVTLLSVDKIPGLNTLEISLARLDYGPNRRLNPPNTHPRGIEILVVIKDKLYVGFVTSSPNNRLISKILYLDDVFVFPVELVHFQLNIDRAPAGTFAD*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTATTCCTTTGCTAAGTCCTCGTTCGTAACCCTCTTCATAATCGTATCGGTGCTGGCTGCAACCAGTAACGCCCAACTGGCTGGGAACTTCTACGCTCGAACATGCCCTAACGTT
CAAGGCATCGTTCGGGGTGCGATGAGGGAAGCTGTTAATAGAGAGCCCCGCCTCGGTGCTTCTATCCTTCGCTTGTTCTTCCACGACTGTTTCGTCAAT
GTAAGTTGTGTAGCGATTGAT
CATTCATTATATTCTCGTGAATATAAAATATATGTTGTTACCAAATTTCTAATCTTCGAACGGTTATCTCTTCCTTTTTAGGGATGCGACGGGTCTATTTTGCTCGATGACACGTCAACA
TTTACGGGGGAGAAGAACGCAATTCCGAATCGGAACTCAGCTAGAGGGTTTGAAGTGATAGACACCATCAAAACTAGGGTTGAAAGAGCCTGCAGTGCCACCGTCTCTTGTGCTGACATC
CTTGCAATTGCCGCAAGAGACGGTGTCGTATTG
GTAATAATACTCTTCTGTTCACTTGCCCTAATCAATTATTAAGCCTACATGAAAAAGTCATTAAGATTTTTTTATGTGTGCAACTAC
ACCGACTCCAATCATTAACTAATGAATTAGATTTTCGAATCTTACTATTTTTTTAAAACAAAATCAAATCAAATCTTATTATTTTAACAGCATAAAAGGTGGAAAATGACACCAACGACG
TTAACCTTTTTTTTTATTTTTGCATGCAGCTTGGTGGGCCATCGTGGCAAGTCCTACTGGGCCGGAGGGACGCAAGAACAGCCAGCCAAAGCGACGCCAACAATGATCTCCCCTCCCCAT
TCTCCGACCTCCCAGCCCTAATCTCTTCATTCACCAATAAGGGCCTAACCGCCGCCGACATGACCGTCCTGTCCGGCTGCCCCATTCGACAATGCTTATTACAGGGAGCTTGTGGGCCAG
CGTGGGCTACTGCACTCCGACCAGCAGCTGTTCAGCGGTGGGTCCCAAGATGCTTTG
GTCAGGACTTATAGTACCAATGTCAATGCTTTTGTTAGGGATTTTGCAAATGCCATGATTAGG
ATGGGGAACCTCAGTCCTCTCACTGGGACTAATGGCGAGATAAGGCGTAATTGCAGGCTTATTAATTAATTATTTAGAGTACGTAAGGTTTCCAATCAATTATGTTTGGAAGTGTTGTAC
TACTACTGTGCTCGTGGAGTATTTTAAGAGGTATTGGTTTTTATGTCGTAACGTCCATAAATGGAGATCGATATAATATTTATTTTCTTTTTATAACAAAAAATTATCTATTTCTAAATA
AATTTGTATGTTTATCGCTACTGGTTACTAATCGACTTTCAACCTCTTATTTAGAGCTGTTTACGAATTGAGTCGAGCCGAACTGTACTGTGCTCAAACTTGGTTTGTTACTTTTTAGGC
GAGCACAAGTTCGAACTTGAGTTAGAAAATGTTAGCTCGTCTCGAGCTCGAGCTTATTCGAGTCTGGCTCGTTAACTACCACAAACTTCACTCATTAAAATTTCTTGATGAGTTTATTTT
GAACTGATTTTAAAGTTTGTATAAAACAAATATCGACAAGTCAAAGCTAAAAAAAACAGATAACCTAAAATATACAAATTTCCACTTTTTCCAATTAAAATAGCTGAACATAAATAATAT
GTGACTTGCATTTTTATTAATGGCACAACAACAAATTACATATATCATTTATTATATATGGTTTTTAAGTAAAACATATACTCGAGTTGGCTCTCAAGCCCAATCTCGAGCTAGTTCGTC
AGCCTTCCGAGTCGAACATACCTTGACTCAAATTTAGCTCATTTAAAATCGAGCTAAGTCATGAACGAGTTTTTTCTGAGTCGAACACCAAGCCAAACGCGAATTGCTTGATTCGTCATC
AGCTCTGTCTTATCATAGTTGACTTCTATCCTCAATGGCTTAATGCATTATAATAGAACTAGTTTAACGAGAAAATATCAAAACAAATCACGATCATCAATCTAATCAACACGTATTGTA
CATTAGATTAATTAGATCATTGAAACAGTCGAATGATCATTTGCTTAATTAGATCATTGGTTTAAGCAACTCCAGTCTCCAGGGAAAGGGATGGGTGTGGAGTTTCCGCAAATAGTTACT
CTACATAATAATATTGAGCGGTTACAAAAATAAGATTAATAACTATTATTTTAATACAAAAGATTGTATGAATAAATAAATAAATATATAGTAACCGATGAAGATCTCTACATAATTAAT
ATGATCAATAACTATTTTAATACAGATTAAGGATTCTGACCACCACCTCTGTCCCTATATACATATAGTTCGAAATGATGACTTCTTCCTGGGATCAATTGGGTGCCTCTTGGCGATGTC
TTCGTTGTGCTTTGCCTACGATCCCAGCCCTCTCCAGGACTTCTGTGTTGCCACTGATGATCCTAAACATGGAGTGTTTGTGCACAGAAAGTTCTGGAAGGATCTCAGGCTAATGTAGAT
GACTTCTCCTTCAATGGACTCAACGTCCCGAGAACCATATCCTCCAACAAAGTGGGTTCGAACGTCACTCTTCTCAGTGTCGACAAGATTCCAGGTCTCAACACCTTGGAAATTTCTTTA
GCTCGTCTCGACTATGGTCCCAATAGAAGACTCAACCCACCCAACACCCATCCTCGTGGCATCGAGATTTTGGTTGTCATTAAGGACAAACTCTACGTCGGGTTTGTTACTTCCAGCCCA
AATAATCGTCTCATCAGCAAGATACTTTACCTCGATGACGTGTTTGTTTTCCCAGTTGAACTCGTCCATTTCCAGCTCAATATCGATAGAGCTCCGGCTGGGACATTTGCGGATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTATTCCTTTGCTAAGTCCTCGTTCGTAACCCTCTTCATAATCGTATCGGTGCTGGCTGCAACCAGTAACGCCCAACTGGCTGGGAACTTCTACGCTCGAACATGCCCTAACGTT
CAAGGCATCGTTCGGGGTGCGATGAGGGAAGCTGTTAATAGAGAGCCCCGCCTCGGTGCTTCTATCCTTCGCTTGTTCTTCCACGACTGTTTCGTCAAT
GGATGCGACGGGTCTATTTTG
CTCGATGACACGTCAACATTTACGGGGGAGAAGAACGCAATTCCGAATCGGAACTCAGCTAGAGGGTTTGAAGTGATAGACACCATCAAAACTAGGGTTGAAAGAGCCTGCAGTGCCACC
GTCTCTTGTGCTGACATCCTTGCAATTGCCGCAAGAGACGGTGTCGTATTG
CTTGGTGGGCCATCGTGGCAAGTCCTACTGGGCCGGAGGGACGCAAGAACAGCCAGCCAAAGCGACGCC
AACAATGATCTCCCCTCCCCATTCTCCGACCTCCCAGCCCTAATCTCTTCATTCACCAATAAGGGCCTAACCGCCGCCGACATGACCGTCCTGTCCGGCTGCCCCATTCGACAATGCTTA
TTACAGGGAGCTTGTGGGCCAGCGTGGGCTACTGCACTCCGACCAGCAGCTGTTCAGCGGTGGGTCCCAAGATGCTTTG
ATGACTTCTCCTTCAATGGACTCAACGTCCCGAGAACCATA
TCCTCCAACAAAGTGGGTTCGAACGTCACTCTTCTCAGTGTCGACAAGATTCCAGGTCTCAACACCTTGGAAATTTCTTTAGCTCGTCTCGACTATGGTCCCAATAGAAGACTCAACCCA
CCCAACACCCATCCTCGTGGCATCGAGATTTTGGTTGTCATTAAGGACAAACTCTACGTCGGGTTTGTTACTTCCAGCCCAAATAATCGTCTCATCAGCAAGATACTTTACCTCGATGAC
GTGTTTGTTTTCCCAGTTGAACTCGTCCATTTCCAGCTCAATATCGATAGAGCTCCGGCTGGGACATTTGCGGATTGA

Retrieve as FASTA