Entry information : LuPrx36(Lus10007051|PACid:23153237)
Entry ID 12156
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx36(Lus10007051|PACid:23153237)
Name LuPrx36(Lus10007051|PACid:23153237)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx36
start..stop
S start..stop
LuPrx37 643 0 1..323 1..324
RcPrx54 489 3e-176 5..323 6..324
CclPrx41 484 3e-174 6..323 7..325
CsPrx44 484 5e-174 6..323 7..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4708..5094 387 N° 2 5221..5383 163 N° 3 5485..5906 422  
join(4708..5094,5221..5383,5485..5906)


exon

Literature and cross-references LuPrx36(Lus10007051|PACid:23153237)
DNA ref. Phytozome 12:   scaffold772 (4708..5906)
Protein sequence: LuPrx36(Lus10007051|PACid:23153237)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (302)
PWM (Da):   %s   34536.34 (32057.1)  
PI (pH):   %s   8.4 (8.40) Peptide Signal:   %s   cut: 22 range:22-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTLFVLWLVMFLANRSAVDAQGTRVGFYSTSCPRAESIVRATVQSHFNSDPTIAPGILRMHFHDCFVHGCDGSILLDGANAEKTAVPNLQLRGYDVIDDAKTQIEAACPGVVSCADILALAARDSVAVTRGPSWTVPTGRRDGRVSLASDTTNLPAFNDSAAVQISKYTQKGLNTQDLVALSGAHTIGTAACAVFRYRLYNFPGSASGADPTLDPAFVPQLRAVCPQNGNAARRVAMDTGSPNRFDNSYYANLRSGRTVLESDSVLWTDAGTRVMAQRFLGIRGLAGLTFAVEFARSMVRMGNIEIKSGAQGEIRRVCSAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGACGCTGTTTGTGTTATGGCTTGTGATGTTTCTAGCCAACAGGTCCGCTGTTGATGCCCAAGGGACTCGGGTTGGCTTCTATTCAACCTCATGCCCACGAGCCGAGTCTATTGTT
CGAGCAACGGTCCAGTCACATTTCAACTCCGACCCCACGATTGCCCCAGGCATACTGAGGATGCACTTCCATGACTGTTTCGTCCACGGATGCGACGGTTCCATCCTTCTCGACGGCGCC
AACGCTGAGAAAACGGCCGTTCCCAATCTCCAGCTCAGAGGCTACGATGTGATCGACGATGCCAAGACCCAGATCGAAGCAGCTTGCCCTGGCGTCGTCTCTTGTGCCGACATTCTTGCA
CTTGCTGCCCGCGACTCTGTTGCCGTG
GTAAGTAATTAAACTGTGACTCTATTAAATCATTACTGTAATTAATAAACATACAAATTAAACAGGATCAATTAGTATATTTATTTTTGTTGT
AATTAACTGTGAATTTGATTTTGCGGTATACAGACACGTGGCCCAAGCTGGACGGTGCCGACCGGGAGGAGAGACGGAAGGGTGTCATTGGCATCGGACACAACCAATTTGCCGGCGTTC
AATGACTCGGCCGCAGTTCAAATTAGCAAGTACACTCAGAAAGGACTCAACACTCAGGATCTTGTTGCTCTTTCTG
GTACTTATGTGGACAATTAATAGATTTGAAATCAAGTAATTAAT
CTCATTCATTATCAGCTAATTAATTAATTATCTACTCCCATGATGTTTGACTTACAGGGGCCCACACAATAGGGACGGCTGCCTGCGCGGTATTCCGGTACAGGCTGTACAACTTTCCTG
GCTCTGCTTCCGGCGCCGACCCAACGCTTGACCCGGCATTTGTTCCCCAACTGAGGGCGGTCTGCCCACAGAACGGAAATGCGGCAAGGAGGGTTGCTATGGACACTGGAAGCCCTAACC
GATTCGACAATTCATACTACGCTAATCTCAGGAGCGGCCGAACTGTTCTTGAATCGGACTCTGTTCTGTGGACGGATGCCGGGACCAGAGTGATGGCACAGAGGTTCCTCGGGATCAGAG
GATTGGCCGGCTTGACTTTCGCAGTGGAGTTCGCCAGATCGATGGTGAGGATGGGCAACATCGAAATCAAGAGCGGCGCCCAGGGTGAGATCCGGCGAGTCTGCTCCGCCGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGACGCTGTTTGTGTTATGGCTTGTGATGTTTCTAGCCAACAGGTCCGCTGTTGATGCCCAAGGGACTCGGGTTGGCTTCTATTCAACCTCATGCCCACGAGCCGAGTCTATTGTT
CGAGCAACGGTCCAGTCACATTTCAACTCCGACCCCACGATTGCCCCAGGCATACTGAGGATGCACTTCCATGACTGTTTCGTCCACGGATGCGACGGTTCCATCCTTCTCGACGGCGCC
AACGCTGAGAAAACGGCCGTTCCCAATCTCCAGCTCAGAGGCTACGATGTGATCGACGATGCCAAGACCCAGATCGAAGCAGCTTGCCCTGGCGTCGTCTCTTGTGCCGACATTCTTGCA
CTTGCTGCCCGCGACTCTGTTGCCGTG
ACACGTGGCCCAAGCTGGACGGTGCCGACCGGGAGGAGAGACGGAAGGGTGTCATTGGCATCGGACACAACCAATTTGCCGGCGTTCAATGAC
TCGGCCGCAGTTCAAATTAGCAAGTACACTCAGAAAGGACTCAACACTCAGGATCTTGTTGCTCTTTCTG
GGGCCCACACAATAGGGACGGCTGCCTGCGCGGTATTCCGGTACAGGCTG
TACAACTTTCCTGGCTCTGCTTCCGGCGCCGACCCAACGCTTGACCCGGCATTTGTTCCCCAACTGAGGGCGGTCTGCCCACAGAACGGAAATGCGGCAAGGAGGGTTGCTATGGACACT
GGAAGCCCTAACCGATTCGACAATTCATACTACGCTAATCTCAGGAGCGGCCGAACTGTTCTTGAATCGGACTCTGTTCTGTGGACGGATGCCGGGACCAGAGTGATGGCACAGAGGTTC
CTCGGGATCAGAGGATTGGCCGGCTTGACTTTCGCAGTGGAGTTCGCCAGATCGATGGTGAGGATGGGCAACATCGAAATCAAGAGCGGCGCCCAGGGTGAGATCCGGCGAGTCTGCTCC
GCCGTCAACTGA

Retrieve as FASTA