Entry information : LuPrx39(Lus10007638|PACid:23140290)
Entry ID 12158
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx39(Lus10007638|PACid:23140290)
Name LuPrx39(Lus10007638|PACid:23140290)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx39
start..stop
S start..stop
LuPrx99 634 0 1..325 1..324
LuPrx33 477 2e-171 20..325 19..324
MePrx97 457 2e-163 1..325 1..328
MePrx108 450 1e-160 1..325 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 164903..165118 216 N° 2 164603..164791 189 N° 3 163949..164521 573  
complement(join(163949..164521,164603..164791,164903..165118))


exon

Literature and cross-references LuPrx39(Lus10007638|PACid:23140290)
DNA ref. Phytozome 12:   scaffold121 (165118..163949)
Protein sequence: LuPrx39(Lus10007638|PACid:23140290)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (300)
PWM (Da):   %s   35457.08 (32666.6) Transmb domain:   %s   o10-32i
PI (pH):   %s   8.99 (8.85) Peptide Signal:   %s   cut: 26 range:26-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATSSSLSKYLFLALFLGLFTISNAQLKVGYYSKTCPNAEAIVKKEMDQVMYVAPSLGGPLVRMHFHDCFVRGCDGSVLIASTKTNQAEKDAIPNLSLRGFGVIDRVKNALEKACPGIVSCSDIMAIVVRDVVVALKGQYWEVETGRRDGRVSIMMDALTGSLPPPFSNISTLISGFKAVGLSAKDLVVLQGAHTIGTSHCSSFTTRIYNFTGKGDVDPALDSNYVPMLKSKCTPSDQTTLVEMDPGSFKTFDNEYYKLVAKRRGLFQSDSALMDNPLTKAYVEKYLTVGSTFLKDFGESMVRMGRIGVLTGKQGEIRKVCYKTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTTCTTCTTCTTTATCAAAGTACTTGTTCTTGGCTTTGTTTCTTGGCCTCTTCACGATCTCAAACGCCCAACTCAAAGTGGGTTACTACTCAAAGACTTGCCCTAATGCTGAG
GCCATAGTCAAGAAGGAGATGGATCAAGTCATGTACGTGGCTCCTTCCCTCGGTGGGCCCTTGGTCCGCATGCATTTCCACGATTGCTTCGTTAGG
GTAAGTCTTATCTTGAAAACCGTG
CACACTAATGATCATTATCGCATGATTACCTTTATAGGGTTTAGTATGTGTTAGTGTTACTTGTATAACAAAATTCTCTGTCAACAGGGTTGTGACGGTTCTGTTCTAATCGCCTCGACG
AAAACTAACCAAGCTGAAAAGGACGCGATCCCAAACCTCAGTTTGAGAGGGTTTGGAGTCATCGACCGCGTAAAAAACGCTCTAGAGAAGGCATGCCCTGGAATCGTGTCGTGCTCTGAT
ATCATGGCTATCGTAGTTAGAGATGTTGTAGTCGCG
GTAAATAACTTTTCATCCTTTCAATCTCCTTTTATGAGCTTTCGTTACAATGAGATATAACAAGCTCTCGTGCCACTACAGTTG
AAAGGTCAGTACTGGGAAGTCGAAACTGGCAGGAGAGACGGACGAGTTTCGATCATGATGGACGCGCTGACAGGATCCCTCCCACCGCCATTTTCGAACATCTCGACCCTTATCTCGGGA
TTCAAAGCCGTTGGACTCTCTGCCAAGGACTTGGTGGTCTTACAAGGCGCCCACACCATAGGAACCTCCCATTGCTCTTCCTTCACAACCAGAATCTACAACTTCACCGGCAAAGGTGAC
GTGGATCCGGCACTCGACTCCAACTACGTGCCCATGCTCAAGAGCAAATGTACGCCGTCGGATCAGACTACCTTGGTGGAGATGGACCCAGGGAGCTTCAAGACATTTGACAACGAGTAC
TACAAGCTGGTGGCTAAAAGAAGGGGTCTGTTCCAGTCCGACTCGGCACTGATGGACAACCCTTTGACCAAGGCTTACGTGGAGAAGTATCTGACCGTTGGATCGACCTTTTTGAAGGAC
TTTGGCGAGTCGATGGTCAGGATGGGGAGGATTGGTGTGCTTACTGGAAAGCAGGGTGAAATTAGGAAAGTCTGCTACAAGACTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTTCTTCTTCTTTATCAAAGTACTTGTTCTTGGCTTTGTTTCTTGGCCTCTTCACGATCTCAAACGCCCAACTCAAAGTGGGTTACTACTCAAAGACTTGCCCTAATGCTGAG
GCCATAGTCAAGAAGGAGATGGATCAAGTCATGTACGTGGCTCCTTCCCTCGGTGGGCCCTTGGTCCGCATGCATTTCCACGATTGCTTCGTTAGG
GGTTGTGACGGTTCTGTTCTAATC
GCCTCGACGAAAACTAACCAAGCTGAAAAGGACGCGATCCCAAACCTCAGTTTGAGAGGGTTTGGAGTCATCGACCGCGTAAAAAACGCTCTAGAGAAGGCATGCCCTGGAATCGTGTCG
TGCTCTGATATCATGGCTATCGTAGTTAGAGATGTTGTAGTCGCG
TTGAAAGGTCAGTACTGGGAAGTCGAAACTGGCAGGAGAGACGGACGAGTTTCGATCATGATGGACGCGCTGACA
GGATCCCTCCCACCGCCATTTTCGAACATCTCGACCCTTATCTCGGGATTCAAAGCCGTTGGACTCTCTGCCAAGGACTTGGTGGTCTTACAAGGCGCCCACACCATAGGAACCTCCCAT
TGCTCTTCCTTCACAACCAGAATCTACAACTTCACCGGCAAAGGTGACGTGGATCCGGCACTCGACTCCAACTACGTGCCCATGCTCAAGAGCAAATGTACGCCGTCGGATCAGACTACC
TTGGTGGAGATGGACCCAGGGAGCTTCAAGACATTTGACAACGAGTACTACAAGCTGGTGGCTAAAAGAAGGGGTCTGTTCCAGTCCGACTCGGCACTGATGGACAACCCTTTGACCAAG
GCTTACGTGGAGAAGTATCTGACCGTTGGATCGACCTTTTTGAAGGACTTTGGCGAGTCGATGGTCAGGATGGGGAGGATTGGTGTGCTTACTGGAAAGCAGGGTGAAATTAGGAAAGTC
TGCTACAAGACTAATTAG

Retrieve as FASTA