Entry information : LuPrx42 (Lus10008167|PACid:23173792)
Entry ID 12159
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-18 (Christophe Dunand)
Peroxidase information: LuPrx42 (Lus10008167|PACid:23173792)
Name (synonym) LuPrx42 (Lus10008167|PACid:23173792)
Class Class III peroxidase    [Orthogroup: Prx121]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx42
start..stop
S start..stop
LuPrx151 696 0 1..372 1..360
LuPrx149 579 0 8..372 5..354
LuPrx01 567 0 1..372 1..359
LuPrx43 515 0 11..372 3..358
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 84268..84492 225 N° 2 85231..85462 232 N° 3 86589..86753 165 N° 4 86858..87354 497
join(84268..84492,85231..85462,86589..86753,86858..87354)


exon

Literature and cross-references LuPrx42 (Lus10008167|PACid:23173792)
Literature Day A1, Fénart S, Neutelings G, Hawkins S, Rolando C, Tokarski C. Identification of cell wall proteins in the flax (Linum usitatissimum) stem. Proteomics. 2013 13(5):812-25.
DNA ref. Phytozome 12:   scaffold480 (84268..87354)
Protein sequence: LuPrx42 (Lus10008167|PACid:23173792)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   373 (345)
PWM (Da):   %s   39624.83 (36729.5) Transmb domain:   %s   i5-27o
PI (pH):   %s   6.73 (7.25) Peptide Signal:   %s   cut: 28 range:28-372
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMVSMSSLVVSSLMAIMLSFVGASYAQQLTPTFYNPTCPNLVSIVRQVLQNAAMTDPRIGASMIRLHFHDCFVNGCDGSILLDNSATIVSEKQAAPNNNSVRGFEVIDQMKTQVEAACPGIVSCADILTIASEESVVLVRKILQARALGSLGGPSWAVPLGRRDSLTANRSLANSALPPPFFTVPQLKAAFNAVGLNTTTDLVALSGAHTFGRAACGGFVGRLYNFNNTGGPDPTINATFLQTLRQLCPQNGNASVLANLDKTTANTFDSAYFRNLQTREGLLQSDQELFSTPGSDTIAIVNRFATNQTAFFQSFVNSMIRMGNIRPPAGSPSQIRRNCRVVNSASTDFADDSIITIPTGVVDTDGFASDM*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Experimental evidency of cell wall localization.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATGGTATCAATGTCTTCACTTGTAGTTTCTTCGTTGATGGCGATAATGCTATCATTCGTTGGAGCGAGCTACGCACAACAGCTCACTCCGACGTTCTACAACCCAACGTGCCCC
AATTTGGTCAGCATCGTTCGCCAGGTTCTTCAGAATGCCGCCATGACCGATCCTAGAATCGGTGCCAGCATGATCAGGCTTCACTTCCATGACTGCTTCGTCAAT
GTTCGTAAACCCTAA
CTCAACCCTCATCATCTATTTTCCTACTTGTAGGTGGTCTTTTATTCATGTTCTTCTGTAATTTCCAATTTACCTAAAATCCAACATAACTAGTTACAGATACTTGTGAATATTGTCTAC
TAGTGTACTATATATCACTCATAAGCGGATCTGAGGCAAGGACGTCCTCTAAATTCCGGCCCAAACCGATCTTCGGGTACATAGCTACGAAATTAATAGGGAAATTAATTCGAGAAAATA
ATTGCACGTCATAGTGATTTTTCGAATTTAACCTAGTGAATGTTTTGATTGATTCTACTCCCCCAATAAATTTTTTACAAATGATCCAATTTAATTACAAGAATCATCAAACTGATGATG
TACTATTGACATTTAGTGAAAATTTCAGTTCTTTTTGTTTATTTTCAACTTTTCTATGTGCCCTCATATATCATAGATCAGTCAGTGATATTTTTGTTCATCAAGTGAGTGATGAAAATA
TTATATAATTTGAAAAAGAGTCGTAATGAATCAGAGGTTCAATCCATAAAAATAAGAAAGAATGGAATCGATATCATTATTACCTCTAATCTCGATTCAAAAGGATTGATTAAAAGAACC
GATCCATCAATAATATCAATAAATGTATATGTTAGAAAAGTCTAAAAATACATGTGTAGGTTGGTAGGTACATAATTAATCAATTAAGTTGTGTGAGTAATGAATTCTATGGTGAATGTG
TAGGGATGTGACGGATCAATATTGCTGGACAACAGTGCGACGATAGTGAGCGAGAAACAAGCTGCTCCTAACAACAACTCCGTCAGAGGGTTCGAAGTCATCGATCAGATGAAGACCCAG
GTCGAAGCTGCTTGCCCCGGGATCGTTTCTTGTGCCGATATTCTCACCATCGCTTCTGAAGAATCCGTCGTTTTGGTACGTAAAATTCTTCAAGCTCGAGCCCTAGGATCTTTAG
GTTTG
ATCCTCGTCACAGTCTTAACTCTTTTTATGGTATATATATCACAAATTTTGATTTGGTTTACCTGGTCGATCGATAAATACATGGTGTTTGTTTGTTTTTTCAGATTTGGAGGAAATTTG
GTGTGTCATTTTATTGGTTCGATTGAGTGATTTGGTTTAAATGTCACATTTAATTGTGAAACTGAAGTGAGATTTGGAAAGTTATATCAAATCACTTTGTGAATCCCCATGTGATCTAAG
AGGTGGTTTGAAATCCGCTTTATAGATGGAAAGTTATCAAAGTTCAAGTGATTTGAGTAAAAAAAGACGAAATTGTCATATTCGGTTTAAGAAAAGGAGATAATATTTGGGGCTGAATTA
GTAATTTCTCTATGTTTCATAAATTAGAATTCCTTTCTGAAGTCCTAAAACTCTACTAAACACACAAAATAGTTACGAAATATCTAACTATTTCAAATTATTAACTATTTGAAATTATTT
TATATTTGAAAATATTCTCGATCGAATTTCAAAATCAAACGATGAAATAGTATAGTTGATACTTTATTTTTAATTTCCTTGGTAGTAAAGGTAAGAATATCAAAGGGTACCTCTTTATTT
GTTGGGCAAAGTATGATTCATCTAAAAGGGAAAGGAAGAGGAGAAAACAAAGCCACTCTCCTAAATGTCAATATTCCATACAAATATGTGAAGAACATTTTCCCACGGCACAACAAGGAT
TTTGAAAAAGACATTATATGTCGTTGAATTTTACCCCCACGACTACTAAACCCAAAAAAATATTTCAAATTTATAGGAGACTCCAAAAATAATAGTTTAAATTATGTAAAATTTGCAAAG
TTAGATAGAAACATAATTGATGGTTGAATTTTATCGTTTTCGAGAATACACAATAAACAGAGAAATACAACAGAGGGTCTTCGAGATAACGATCTATGGTGATGGGATATGTTTGTGTAC
TATAAATTCGATTCAGGTTTCGAACTATATATTAGCATATTCATACTTCTTATAGAGTCGTCGTGTGCTCGTACGAATTTTGTATAGTAAATTGTTTGTTTTGAGTTTTTAGTAATGTTC
CCTTCTTTATGGTCTCTGAATTTTTGTAATCGAATAGGCAGGAGGGCCGTCATGGGCAGTTCCACTAGGAAGGAGGGACAGCTTGACTGCGAACAGGAGTTTAGCAAATTCAGCACTCCC
ACCTCCCTTTTTCACTGTCCCTCAGCTCAAAGCCGCTTTCAATGCTGTCGGTCTCAACACCACCACTGATCTCGTTGCCCTCTCTG
GTATGCTAATAATCTCTTCTATTACAAATCATCT
CAAATCAAATCCAAAAAATCATTCTAAATCACACCAAATCAATTCCTTCATCGGTATTGCGCGTGGTTAGGTGCTCACACGTTCGGAAGGGCAGCATGCGGAGGATTCGTGGGTCGTCTC
TACAACTTCAACAACACAGGAGGCCCAGACCCAACAATCAACGCCACCTTTCTCCAGACCCTCCGCCAACTCTGCCCTCAGAACGGAAATGCCAGCGTTTTGGCCAACCTCGACAAAACA
ACTGCCAACACATTCGATTCGGCCTATTTCAGAAACCTTCAGACCAGAGAAGGTCTCCTCCAGAGTGACCAGGAACTCTTCTCTACTCCCGGCTCTGACACCATCGCCATCGTCAACAGG
TTCGCCACAAACCAGACGGCCTTCTTCCAGAGCTTTGTGAACTCCATGATTAGGATGGGGAACATTCGCCCTCCGGCTGGGAGTCCGAGCCAAATTAGGCGGAATTGCAGGGTTGTTAAC
TCCGCTTCTACTGATTTCGCTGATGATTCGATTATTACTATTCCGACGGGCGTAGTTGATACAGATGGGTTCGCAAGTGATATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATGGTATCAATGTCTTCACTTGTAGTTTCTTCGTTGATGGCGATAATGCTATCATTCGTTGGAGCGAGCTACGCACAACAGCTCACTCCGACGTTCTACAACCCAACGTGCCCC
AATTTGGTCAGCATCGTTCGCCAGGTTCTTCAGAATGCCGCCATGACCGATCCTAGAATCGGTGCCAGCATGATCAGGCTTCACTTCCATGACTGCTTCGTCAAT
GGATGTGACGGATCA
ATATTGCTGGACAACAGTGCGACGATAGTGAGCGAGAAACAAGCTGCTCCTAACAACAACTCCGTCAGAGGGTTCGAAGTCATCGATCAGATGAAGACCCAGGTCGAAGCTGCTTGCCCC
GGGATCGTTTCTTGTGCCGATATTCTCACCATCGCTTCTGAAGAATCCGTCGTTTTGGTACGTAAAATTCTTCAAGCTCGAGCCCTAGGATCTTTAG
GAGGGCCGTCATGGGCAGTTCCA
CTAGGAAGGAGGGACAGCTTGACTGCGAACAGGAGTTTAGCAAATTCAGCACTCCCACCTCCCTTTTTCACTGTCCCTCAGCTCAAAGCCGCTTTCAATGCTGTCGGTCTCAACACCACC
ACTGATCTCGTTGCCCTCTCTG
GTGCTCACACGTTCGGAAGGGCAGCATGCGGAGGATTCGTGGGTCGTCTCTACAACTTCAACAACACAGGAGGCCCAGACCCAACAATCAACGCCACC
TTTCTCCAGACCCTCCGCCAACTCTGCCCTCAGAACGGAAATGCCAGCGTTTTGGCCAACCTCGACAAAACAACTGCCAACACATTCGATTCGGCCTATTTCAGAAACCTTCAGACCAGA
GAAGGTCTCCTCCAGAGTGACCAGGAACTCTTCTCTACTCCCGGCTCTGACACCATCGCCATCGTCAACAGGTTCGCCACAAACCAGACGGCCTTCTTCCAGAGCTTTGTGAACTCCATG
ATTAGGATGGGGAACATTCGCCCTCCGGCTGGGAGTCCGAGCCAAATTAGGCGGAATTGCAGGGTTGTTAACTCCGCTTCTACTGATTTCGCTGATGATTCGATTATTACTATTCCGACG
GGCGTAGTTGATACAGATGGGTTCGCAAGTGATATGTGA

Retrieve as FASTA