Entry information : LuPrx57(Lus10009901|PACid:23150078)
Entry ID 12168
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx57(Lus10009901|PACid:23150078)
Name LuPrx57(Lus10009901|PACid:23150078)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx57
start..stop
S start..stop
PtPrx58 487 2e-175 1..320 1..322
PtrtrPrx14 476 3e-171 1..320 1..322
MePrx30 472 1e-169 22..320 24..324
CroPrx13 468 9e-168 11..320 8..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 39446..39658 213 N° 2 39153..39329 177 N° 3 38312..38884 573  
complement(join(38312..38884,39153..39329,39446..39658))


exon

Literature and cross-references LuPrx57(Lus10009901|PACid:23150078)
DNA ref. Phytozome 12:   scaffold200 (39658..38312)
Protein sequence: LuPrx57(Lus10009901|PACid:23150078)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (296)
PWM (Da):   %s   34525.3 (31720.8)  
PI (pH):   %s   5.76 (5.75) Peptide Signal:   %s   cut: 25 range:25-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDTSLFKLPLYCLVLITLIPLVTCQLDYNFYGGSCPSLTKMVKYGVWSAISNDTRMAASLLRLHFHDCFVNGCDGSVLLDGGEKNALPNRNSARGFEVIDNINANLEKACPGIVSCTDILTLAAREAVSLIGGPYWGLALGRRDGMTSSESAANEQLPGPFESLDNITRKFIAKGLDLKDIVVLSGAHTIGFAQCGVVKPRLFDFGGSGGPDPSLDASFLQTLQNICPNQNDSNAKLAPLDTSSTKFDNLYYKLLMNSSGLLQSDQALMSDNTTASMVINYSKFPFLFYKDFGISMVKMAGIGVLTGSDGEIRKNCRVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATACCAGTTTGTTCAAACTTCCCTTGTACTGCCTTGTTCTGATCACGTTGATCCCTCTTGTGACATGCCAACTTGACTACAACTTCTACGGTGGTTCCTGTCCGAGCCTGACAAAG
ATGGTTAAATATGGTGTCTGGTCTGCCATTTCTAATGATACCAGGATGGCTGCTTCCCTCCTGCGCCTTCACTTCCATGATTGTTTTGTTAAC
GTATATATATCAACCTCCAACCAACCA
TAATTGCTCTGTTTTTCTTTGTTGGCTCACCGTATATGTATCACTTCTTCCATGTTGCTGAGCTAGAATTTGGATGCCTGGTTTTATAGGGATGTGATGGATCTGTTTTGCTGGACGGTG
GGGAGAAAAACGCCCTTCCGAATCGAAATTCAGCCAGAGGATTTGAAGTCATTGATAACATCAACGCCAACTTGGAAAAAGCCTGTCCCGGAATTGTCTCTTGTACTGATATTCTTACTC
TTGCAGCCAGAGAAGCGGTTTCTCTC
GTAACATACTAAACCCCCCATCGTCATTTTTAACTTCTTCTCGTAACAAAATCGTTGATTGGTAGCGAAAATTTAACATGGGTTGGCCAAATCC
AATTTAAAATATGCACTTTTAACAGGGGATTGCAACAGCTCGCAAACTATGCCTGTTTAACAGGGGTTATAAACCCCTGCCAACAGAGACCAAAATCCCTATTGTACGGGTTTGGGCCTC
CGTTTCCCGATATATGTGTAGTGTGTTCTTTTAAGTTGTTCTATTGGTTCTCAGATAGGAGGGCCATACTGGGGACTTGCTTTAGGCAGGAGGGATGGGATGACATCAAGCGAGAGTGCA
GCAAACGAGCAGCTCCCAGGACCATTCGAGTCATTGGACAACATTACTAGAAAGTTCATAGCAAAGGGTCTCGATTTGAAAGACATAGTTGTGCTCTCAGGAGCGCACACGATTGGTTTT
GCTCAGTGTGGAGTGGTCAAGCCTAGGCTTTTCGACTTTGGTGGCTCTGGGGGACCGGATCCATCGCTCGATGCATCGTTTCTCCAGACCCTACAGAATATCTGCCCAAACCAGAATGAT
TCCAACGCTAAGTTGGCTCCTCTGGATACAAGTTCAACCAAGTTTGATAACCTTTACTACAAGCTACTAATGAATAGCTCAGGGTTGTTGCAGTCCGACCAAGCTTTGATGTCGGATAAC
ACGACTGCTTCGATGGTTATTAACTATAGCAAGTTCCCTTTCCTATTCTACAAGGATTTTGGAATTTCAATGGTGAAAATGGCTGGTATTGGCGTGCTCACTGGGAGTGATGGGGAGATC
AGGAAGAATTGTAGGGTGGTAAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATACCAGTTTGTTCAAACTTCCCTTGTACTGCCTTGTTCTGATCACGTTGATCCCTCTTGTGACATGCCAACTTGACTACAACTTCTACGGTGGTTCCTGTCCGAGCCTGACAAAG
ATGGTTAAATATGGTGTCTGGTCTGCCATTTCTAATGATACCAGGATGGCTGCTTCCCTCCTGCGCCTTCACTTCCATGATTGTTTTGTTAAC
GGATGTGATGGATCTGTTTTGCTGGAC
GGTGGGGAGAAAAACGCCCTTCCGAATCGAAATTCAGCCAGAGGATTTGAAGTCATTGATAACATCAACGCCAACTTGGAAAAAGCCTGTCCCGGAATTGTCTCTTGTACTGATATTCTT
ACTCTTGCAGCCAGAGAAGCGGTTTCTCTC
ATAGGAGGGCCATACTGGGGACTTGCTTTAGGCAGGAGGGATGGGATGACATCAAGCGAGAGTGCAGCAAACGAGCAGCTCCCAGGACCA
TTCGAGTCATTGGACAACATTACTAGAAAGTTCATAGCAAAGGGTCTCGATTTGAAAGACATAGTTGTGCTCTCAGGAGCGCACACGATTGGTTTTGCTCAGTGTGGAGTGGTCAAGCCT
AGGCTTTTCGACTTTGGTGGCTCTGGGGGACCGGATCCATCGCTCGATGCATCGTTTCTCCAGACCCTACAGAATATCTGCCCAAACCAGAATGATTCCAACGCTAAGTTGGCTCCTCTG
GATACAAGTTCAACCAAGTTTGATAACCTTTACTACAAGCTACTAATGAATAGCTCAGGGTTGTTGCAGTCCGACCAAGCTTTGATGTCGGATAACACGACTGCTTCGATGGTTATTAAC
TATAGCAAGTTCCCTTTCCTATTCTACAAGGATTTTGGAATTTCAATGGTGAAAATGGCTGGTATTGGCGTGCTCACTGGGAGTGATGGGGAGATCAGGAAGAATTGTAGGGTGGTAAAC
TAG

Retrieve as FASTA