Entry information : LuPrx69 (Lus10011079|PACid:23165729)
Entry ID 12178
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-09-29 (Christophe Dunand)
Peroxidase information: LuPrx69 (Lus10011079|PACid:23165729)
Name (synonym) LuPrx69 (Lus10011079|PACid:23165729)
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type Seed coats
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx69
start..stop
S start..stop
RcPrx21 557 0 35..340 28..333
EgrPrx134 536 0 28..340 16..328
EglPrx134 532 0 28..340 16..328
EguPrx134 531 0 28..340 16..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 237255..237506 252 N° 2 236916..237116 201 N° 3 236652..236817 166 N° 4 234831..235237 407
complement(join(234831..235237,236652..236817,236916..237116,237255..237506))


exon

Literature and cross-references LuPrx69 (Lus10011079|PACid:23165729)
DNA ref. Phytozome 12:   scaffold314 (237506..234831)
EST ref. GenBank:   JG245901.1
Protein sequence: LuPrx69 (Lus10011079|PACid:23165729)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   342
PWM (Da):   %s   36746.69 Transmb domain:   %s   i9-31o
PI (pH):   %s   9.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRRRRRQLLIISSNNMNLVMAITLAGFLLFSAPAAAQLRQNYYANVCPNVEGIVRAAVQKKIQQTFVTIPATIRLFFHDCFVQGCDASVIVASTGSNKAEKDHPDNLSLAGDGFDTVIKAKQAVDAVAGCRNKVSCADILALATRDVIALSGGPTYAVELGRLDGLSSTAGSVNGRLPQPNFTLNQLNSLFAANGLSQSDMIALSAAHTVGFSHCGKFANRIYNFSRGNSVDPTLNPGYATRLQQMCPRNVDPRIAINMDPFTPNTFDNTYFKNLQQGMGLFTSDQILFTDTRSKPTVDSWATNSFAFQQAFINAITKLGRVGVKTGKNGNIRTDCGVLG*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGCGGAGGCGGCGGCGACAGCTCCTGATCATCAGCAGCAATAACATGAATCTGGTGATGGCGATTACCCTGGCGGGCTTTCTCCTATTCTCAGCTCCCGCAGCGGCACAGCTCAGA
CAGAACTACTACGCCAATGTGTGCCCAAATGTTGAGGGTATAGTAAGAGCCGCCGTCCAGAAGAAGATTCAGCAGACATTCGTCACCATCCCGGCCACCATCCGCCTCTTCTTCCATGAT
TGCTTTGTCCAG
GTCAGTCGTCTACTATCCATTATTAATTATTCACTACTAGTCTTGCTAATTATTTATTTTACTAACCGGCTGGCCCGGCCCAGCCCATATATGAAAGTACCTAATTAA
TTGATCTATATATTTAATAATTAATTGAAGGGATGTGATGCGTCGGTGATAGTGGCGTCGACGGGGAGCAACAAGGCGGAGAAGGACCATCCTGACAACCTGTCGCTAGCCGGAGATGGG
TTCGACACAGTGATAAAGGCAAAGCAGGCGGTTGATGCGGTGGCAGGGTGCAGGAACAAGGTCTCTTGCGCTGATATTCTTGCTTTGGCCACTAGAGACGTTATTGCTTTG
GTATGTCCT
GTCCACGCTCTAACGAAATCTCCCACTAGCTACATACTACTTTTAATCGATCCCCACTTTCATTATGTTTTGTTTGTGAAAAAAAATAGTCGGGAGGACCAACGTACGCCGTGGAACTGG
GGAGACTGGACGGATTGAGCTCAACGGCTGGGAGTGTGAACGGAAGGCTGCCGCAGCCCAATTTTACCCTAAACCAACTCAACTCCCTCTTCGCTGCTAACGGACTCTCCCAGTCTGACA
TGATCGCTCTCTCTG
GTAAACATTTTCCTTTGTTATTTTTCGCTTTATAGAAACTTATTAATTATTAATTACAAAATGCTTCCAAATGAGAGAGCCACTAAAACTTACGGAGAAATTTTT
CAGAAACCCGTGACTGCAAATTGTCATCATCCTAAGTCTTAATATCTGCTTTTATTAATTATCTTACTTGTTAGAGGCCTCTCATATTCTAATTTTCTTTTTTTCAGAATAAATTTTTGA
TCAATATAAAATAAAAATCTATATAAATATTAGAATAACATTGTTTGTGGAATATATAATTTAAATTTAAAATTTTTAAATTATCGCCCATAACTTTATTATTGAAATAATTTTATATAG
ACTTGTTGTGGATAAAAATGTAAATCCCTCTAACGAATTGTCACCTTCCGCTTCCCCGTAGCTCAACTTGTTAGTGAGGGAAGGAAGTCAACTTTATTAAAGTAGGAAAAATGCTTTTTG
CCAACCATGATTCCCGCCCACAGACGTATCACATTGGACAATTCAGTTCCCCACATTTACCTGGAGAGGAATATCATGTTATCCCTTCCATTTTTAATATTCTTACTGAAAATGATGGGG
AAAAACAAAGAAAGAACATTTGTTTATCGGAAATAACATTGTTCGAGCTAGTACAATTTTTTTGGCATGTTTGAGATCCGTAGGACCGCTAACTGGCTCCGCATACTGTAGCGCGGGCCG
TTTAGACCAAGCTTGTATACTTACACTTTTTTTACAAATATAATAAGTGATTCGAACCATGGAAAAATAAAATATTTTTTCAAGTGGTGAGAATATTGGTTTTGATAGATTCATTTTTTT
AAATAAATCTTTCTATACAAATGAAGATTCTTTATCAAAAAAATATAAATGAAGAGTTATGTTAGGTTTAGAATATGCGGGGCAAAATAGAAACCAAAGTTTTCTGAAAAATCTAAAACT
ATTTCAAAAAAATCATTGTTGTTCTGAAAAGTTGGTAGTTGTTGACTTGTTTCAGCATGATGTTTAAATTCAATTTCAACACGTGAAATAGCACCCGTGTGTGTTGGTATAATGCGAATT
CCGCCGGCTATCTGGTCTAACTTGCTAGTTTTATTTTTTGGTCACGTCATAGTGAAATGGTTAAGCTAGTATAGGGGTCGAAAAATAATTTGAAATTGTAATTGTAGAATTGAATCGCAA
TATTATAAAATTTTACGATTTTTTATAATAGTAAATTTAAAGAAAACTGTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAAATCAAAATTTTATATAATTT
TATTAATTATCAATTTTTAATAAAATCAAAATCATTAAATATTATTAAAATTATTAAAACCATATAATTTTAAAATTTAAATTGTCAATTTCATAACTTTTGGTCACAGCTGCTCATACC
GTCGGATTCTCCCACTGTGGGAAATTCGCAAATAGGATATACAACTTCAGCCGCGGGAACTCGGTGGACCCAACTCTTAACCCGGGATACGCGACCCGGCTCCAGCAGATGTGCCCGAGG
AACGTTGACCCGAGGATAGCCATCAACATGGATCCCTTCACACCTAACACCTTCGACAACACATACTTCAAGAACCTCCAGCAAGGCATGGGCCTTTTCACATCTGACCAGATCCTCTTC
ACGGACACCAGGTCCAAGCCCACTGTCGACTCATGGGCCACCAATTCCTTCGCATTTCAGCAGGCTTTCATCAATGCTATCACTAAGCTGGGTCGGGTCGGTGTCAAAACGGGGAAGAAC
GGAAATATCCGGACCGATTGTGGTGTTCTGGGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGCGGAGGCGGCGGCGACAGCTCCTGATCATCAGCAGCAATAACATGAATCTGGTGATGGCGATTACCCTGGCGGGCTTTCTCCTATTCTCAGCTCCCGCAGCGGCACAGCTCAGA
CAGAACTACTACGCCAATGTGTGCCCAAATGTTGAGGGTATAGTAAGAGCCGCCGTCCAGAAGAAGATTCAGCAGACATTCGTCACCATCCCGGCCACCATCCGCCTCTTCTTCCATGAT
TGCTTTGTCCAG
GGATGTGATGCGTCGGTGATAGTGGCGTCGACGGGGAGCAACAAGGCGGAGAAGGACCATCCTGACAACCTGTCGCTAGCCGGAGATGGGTTCGACACAGTGATAAAG
GCAAAGCAGGCGGTTGATGCGGTGGCAGGGTGCAGGAACAAGGTCTCTTGCGCTGATATTCTTGCTTTGGCCACTAGAGACGTTATTGCTTTG
TCGGGAGGACCAACGTACGCCGTGGAA
CTGGGGAGACTGGACGGATTGAGCTCAACGGCTGGGAGTGTGAACGGAAGGCTGCCGCAGCCCAATTTTACCCTAAACCAACTCAACTCCCTCTTCGCTGCTAACGGACTCTCCCAGTCT
GACATGATCGCTCTCTCTG
CTGCTCATACCGTCGGATTCTCCCACTGTGGGAAATTCGCAAATAGGATATACAACTTCAGCCGCGGGAACTCGGTGGACCCAACTCTTAACCCGGGATAC
GCGACCCGGCTCCAGCAGATGTGCCCGAGGAACGTTGACCCGAGGATAGCCATCAACATGGATCCCTTCACACCTAACACCTTCGACAACACATACTTCAAGAACCTCCAGCAAGGCATG
GGCCTTTTCACATCTGACCAGATCCTCTTCACGGACACCAGGTCCAAGCCCACTGTCGACTCATGGGCCACCAATTCCTTCGCATTTCAGCAGGCTTTCATCAATGCTATCACTAAGCTG
GGTCGGGTCGGTGTCAAAACGGGGAAGAACGGAAATATCCGGACCGATTGTGGTGTTCTGGGCTGA

Retrieve as FASTA