Entry information : LuPrx73(Lus10012684|PACid:23148196)
Entry ID 12180
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx73(Lus10012684|PACid:23148196)
Name LuPrx73(Lus10012684|PACid:23148196)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx73
start..stop
S start..stop
LuPrx114 592 0 1..325 1..333
CanPrx01 476 1e-170 5..325 15..332
RcPrx54 469 3e-168 1..325 1..324
StPrx28 468 1e-167 1..325 12..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 68023..68415 393 N° 2 66320..66904 585  
complement(join(66320..66904,68023..68415))


exon

Literature and cross-references LuPrx73(Lus10012684|PACid:23148196)
DNA ref. Phytozome 12:   scaffold206 (68415..66320)
Protein sequence: LuPrx73(Lus10012684|PACid:23148196)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (302)
PWM (Da):   %s   34659.17 (32206.8)  
PI (pH):   %s   6.65 (6.50) Peptide Signal:   %s   cut: 24 range:24-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATSALILTLVLAMSALTIMVHGQGTRVGFYSTSCPRVETIVRTAVQSHFASDPTVAAGLLRMHFHDCFVQGCDASVLILGTGTERTAVPNQSLNGFSTIDDAKTQLEAACPGVVSCADILALAARDSVVLTSGLSWPVPTGRRDGRVSVQQEADDNLPGPADTVDSQIQQFSTLGLNVQDLVTLSAGHTLGTASCATFSYRLYNYNNTGGPDPSIAPAFLTTLRSFCPQNGDGSRRVAMDTGSQNRFDNSYFTNIRNGRGVLESDQRMWTDSRTSGFVDRYLGLSGLLGLTFNVEFGRSMVKMSNIGVKTGTNGEIRRVCSAIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCTCAGCACTCATACTCACCCTTGTCCTAGCAATGTCTGCCCTAACAATCATGGTCCACGGGCAGGGAACCCGTGTCGGGTTCTACTCAACCAGCTGCCCACGGGTCGAGACC
ATAGTCCGAACCGCGGTCCAATCCCACTTCGCCTCCGACCCTACGGTTGCTGCAGGCTTACTCAGGATGCATTTCCACGACTGTTTCGTGCAGGGCTGCGACGCTTCGGTCCTTATTTTG
GGAACCGGTACCGAGAGAACCGCCGTCCCTAATCAGTCCCTCAACGGCTTCTCAACCATTGATGACGCCAAGACGCAGCTCGAAGCTGCTTGTCCCGGCGTCGTCTCTTGCGCTGACATC
CTTGCTCTCGCTGCTCGCGACTCCGTCGTTTTG
GTAAAATTTCATCAACCCCGGCTAAACACTTAGATTATTATTAATCAAATAAAAGTCATTAATCCTTACAGAAAAAAAATTCATTAA
TAAACTATCCGTTACTATCACTTGCATGTATTTGGCGTAATGTGACTAAGATAATAATAAACTGGACTCTTTAGATTTAACTCTACGATTTTATTCTAATCGGGCTGACCGGTTTAAAAT
CGTAAATCACGTGACCCTACTGGTTCAATGGTTTTCTGGCTTATAACTATTCTCACTTGTTTCTAAATCGATTCTTTGAGGTTATATAAATCATCAAAATCAGTAGAGTAAGATCTGCTA
TTATTCACGAATGTTCAAGATTTTTAATTCTCGCCAATGAGACATTGTTTTCCCCATATTGCAACCTAAAAAAATAACGATTTGTACCATATTTAATTTGATTTTGATAATTTTAGTTCT
ATTCGAAATGAAAATTAAAACATATTTATATTTTATAGTGTATTTCTGTGAATTACTTGAACGTTTGTTTTAACGGTTCGACCCCAGTCAACCTCACGAATTCATGAACCATTTCTAAAA
TCCGGATCTTTACGGTCCGAATCCTCTCCCCTCGGATCACTATTAGTTGGCTAATTTGTCAGTTACATATTGGCTTCAATTGATTTGGACAGCAAAAATTGACTAATTAGTGTTCACTGT
ATGTTTTTTTTATGTAATCATGCTGGTGGATTAGTCCATAAATAATTTAATTAAAGATAATATTTTGATGAAAATATGCATCGGGTATAAATATGACGTGGTAAGTTTTGATTGGTTCTT
CCAATTTTATGCCATTAAAACCCTTAAGTTTATGTAATTAACAACTTCATCACCCCAAAATTTAACCATATTACATTATCGTCGAATATGTTATTTAACATCCTATTTTCTAAAAAATTA
TAATTTATCATCTTCCTTTATTAATTAAAACAAACTTCACCTATTCAATAACCAAAAACCACAATCAATAAAGTGTATGTTTTCACCGAAATATCCGTCTTTAATTAATTAGTTTGGCTG
ATCAGCTATTCAGGAAATAGACTAATGATTGTGATGGTTTCATGTTGCTAATGATTAAATAATTCTATCAGACAAGCGGACTAAGCTGGCCAGTTCCCACGGGGAGAAGAGATGGCAGAG
TTTCAGTCCAACAGGAAGCTGACGACAATTTGCCAGGACCAGCGGACACCGTCGATTCGCAGATCCAGCAGTTTAGCACTCTGGGCCTCAACGTTCAGGATCTCGTCACGCTCTCAGCTG
GACACACTCTAGGGACAGCATCCTGCGCCACATTCAGCTACAGGCTCTACAACTACAACAACACGGGTGGACCCGACCCGTCGATCGCCCCCGCATTCCTCACCACGCTCCGGTCATTCT
GTCCCCAGAACGGCGACGGATCGAGGCGGGTGGCGATGGACACCGGCAGCCAGAACCGGTTCGACAACTCGTATTTTACCAACATCAGGAACGGCCGTGGAGTTCTGGAATCCGACCAGC
GGATGTGGACCGACAGCCGGACGAGTGGCTTTGTGGACCGGTATTTGGGCCTCAGTGGGCTTCTTGGGCTTACCTTTAATGTCGAGTTTGGGAGGTCCATGGTGAAGATGAGTAATATTG
GTGTCAAGACTGGGACAAATGGGGAAATTCGCCGTGTCTGCTCTGCGATTAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCTCAGCACTCATACTCACCCTTGTCCTAGCAATGTCTGCCCTAACAATCATGGTCCACGGGCAGGGAACCCGTGTCGGGTTCTACTCAACCAGCTGCCCACGGGTCGAGACC
ATAGTCCGAACCGCGGTCCAATCCCACTTCGCCTCCGACCCTACGGTTGCTGCAGGCTTACTCAGGATGCATTTCCACGACTGTTTCGTGCAGGGCTGCGACGCTTCGGTCCTTATTTTG
GGAACCGGTACCGAGAGAACCGCCGTCCCTAATCAGTCCCTCAACGGCTTCTCAACCATTGATGACGCCAAGACGCAGCTCGAAGCTGCTTGTCCCGGCGTCGTCTCTTGCGCTGACATC
CTTGCTCTCGCTGCTCGCGACTCCGTCGTTTTG
ACAAGCGGACTAAGCTGGCCAGTTCCCACGGGGAGAAGAGATGGCAGAGTTTCAGTCCAACAGGAAGCTGACGACAATTTGCCAGGA
CCAGCGGACACCGTCGATTCGCAGATCCAGCAGTTTAGCACTCTGGGCCTCAACGTTCAGGATCTCGTCACGCTCTCAGCTGGACACACTCTAGGGACAGCATCCTGCGCCACATTCAGC
TACAGGCTCTACAACTACAACAACACGGGTGGACCCGACCCGTCGATCGCCCCCGCATTCCTCACCACGCTCCGGTCATTCTGTCCCCAGAACGGCGACGGATCGAGGCGGGTGGCGATG
GACACCGGCAGCCAGAACCGGTTCGACAACTCGTATTTTACCAACATCAGGAACGGCCGTGGAGTTCTGGAATCCGACCAGCGGATGTGGACCGACAGCCGGACGAGTGGCTTTGTGGAC
CGGTATTTGGGCCTCAGTGGGCTTCTTGGGCTTACCTTTAATGTCGAGTTTGGGAGGTCCATGGTGAAGATGAGTAATATTGGTGTCAAGACTGGGACAAATGGGGAAATTCGCCGTGTC
TGCTCTGCGATTAATTAG

Retrieve as FASTA