Entry information : LuPrx78(Lus10013955|PACid:23170116)
Entry ID 12183
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang LI)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx78(Lus10013955|PACid:23170116)
Name LuPrx78(Lus10013955|PACid:23170116)
Class Class III peroxidase    [Orthogroup: Prx026]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx78
start..stop
S start..stop
LuPrx27 644 0 1..344 1..344
EcamPrx78 510 0 5..342 10..348
EgrPrx81 507 0 5..342 10..348
EgrPrx78 503 0 5..341 10..347
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 223716..223970 255 N° 2 224060..224260 201 N° 3 224890..225468 579  
join(223716..223970,224060..224260,224890..225468)


exon

Literature and cross-references LuPrx78(Lus10013955|PACid:23170116)
DNA ref. Phytozome 12:   scaffold820 (223716..225468)
Protein sequence: LuPrx78(Lus10013955|PACid:23170116)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344 (314)
PWM (Da):   %s   37955.63 (34743.8) Transmb domain:   %s   o10-32i
PI (pH):   %s   9.55 (9.58) Peptide Signal:   %s   cut: 31 range:31-344
Sequence 385
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAILPHSPSTFLYISLIILLLHHISTATGAATNRRRLRQLSVNYYARTCPHLEQLVGSVTSQQFKVAPVSGPATIRLFFHDCFVEGCDGSILISTKPGSRELAEKEAEDNKDLRAEGYDTVFKAKSLVETKCPGAISCSDILAIAARDYVHLTGGPYYQVKKGRFDGKTSKATKVPDNIPRSNSTVDALLTLFRTKGLSLQDMVVLSGAHTIGFAHCKQFVTRLYDYKGTKNPDPTLDPRLLKELRISCPRVGSNDKVVVPFDVTTPFKFDHAYYLNLEGKLGLLGSDQGLWMDPRTKGVVQEMGRDRGKFFGMFGLAMEKMGEIGVKSGRRHGEIRRDCSMVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction. Extra 3'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAATTCTTCCACATTCTCCATCCACTTTCCTCTACATTTCTCTTATCATTCTTCTCCTCCATCACATTTCCACAGCCACCGGCGCAGCCACTAACCGCCGGAGGCTACGTCAGCTCT
CCGTCAACTATTACGCCAGGACATGTCCACATCTTGAGCAGCTGGTCGGCTCAGTCACTTCCCAGCAGTTCAAGGTGGCTCCGGTTTCTGGTCCCGCCACCATCCGCCTCTTCTTCCACG
ACTGCTTCGTCGAG
GTAGGCGATTCGGATCGAAATTATGTCAGACTATCATGTCAGACTAATTGTATTCTTCGAATGCTTCTCTAACTCTCTTTGATTCAAAGGGATGCGACGGGTCAAT
TCTGATATCAACGAAGCCAGGAAGCAGAGAATTGGCAGAGAAGGAAGCAGAGGATAATAAGGACCTGAGAGCAGAAGGATACGACACCGTTTTCAAAGCCAAGTCCCTCGTTGAGACCAA
GTGCCCCGGCGCCATCTCTTGCTCCGACATCCTCGCCATTGCCGCCCGTGACTATGTCCACTTA
GTAAGTCTGTCTCCCCCTTTGACCTCTCTCTCAATTATCCAAATTCCCTTAACCGA
ACCGGCCAAAATACTCGAATTGATCCAGTATTTTATTATTAGGTACGAATAAACTTAAAACGGTTATATACGGATACAGGTAGAATATACATGAAATATCTAAATCAAGTCCGAACCAAT
CGATTTAATTCCTATGGACATAGTTTTATAAGGAGATTTTTTTCTTTAAAATGCTGAATTTTAGTTGTGGTTTTAATTGAAAATTTACAAGGGTAAATATGAGTTTTACTACCTGAAAAG
TTTTTTAAAACCGTTATTATCTAAACTCGGAACTAAAATAGATAAAGGAGTAGATACTAACTATTTAAACCTGAATAATCACGTTGCCAAGCCTACTCCAAATATCATTTCATCTCGAGT
AACAAATAAATTAGATCATTGACCACTTAACTTTTACTTTTATTGCATATTTAACCATTAATAAGTGATACATATTCATTAAATTTTAGGATAAGTAACATTTTGTTCATTTAGTTTTTA
ATTTATAACAAGCTCCTAACTTAAATTTTTAGATAATAACAATATTAAACCGGTTCATTCCAATAAATCATTACCTTTACTCGGATGGGCCAGACAGGTGGACCATACTACCAAGTGAAG
AAAGGAAGATTTGACGGGAAAACATCCAAGGCAACAAAAGTACCTGACAACATTCCACGGTCAAATTCGACCGTCGACGCCCTCCTTACCCTCTTCCGAACCAAAGGCCTGTCACTTCAA
GACATGGTGGTCCTATCCGGAGCACATACGATTGGATTCGCACACTGCAAGCAATTCGTCACCAGGCTGTACGACTACAAGGGCACAAAAAACCCCGACCCCACCCTGGACCCGAGGCTA
CTGAAGGAACTAAGAATTTCATGCCCTAGGGTCGGGTCGAATGATAAGGTAGTGGTGCCGTTCGATGTCACGACGCCGTTTAAGTTCGATCATGCTTACTACTTGAACTTGGAAGGGAAG
TTGGGCCTGCTGGGCTCGGATCAGGGCCTGTGGATGGATCCGAGGACCAAGGGTGTGGTCCAGGAGATGGGGAGGGATAGAGGCAAGTTTTTTGGGATGTTTGGTTTGGCTATGGAGAAG
ATGGGGGAGATTGGTGTTAAGAGTGGGAGGAGACATGGTGAGATTAGGAGAGATTGTAGTATGGTTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAATTCTTCCACATTCTCCATCCACTTTCCTCTACATTTCTCTTATCATTCTTCTCCTCCATCACATTTCCACAGCCACCGGCGCAGCCACTAACCGCCGGAGGCTACGTCAGCTCT
CCGTCAACTATTACGCCAGGACATGTCCACATCTTGAGCAGCTGGTCGGCTCAGTCACTTCCCAGCAGTTCAAGGTGGCTCCGGTTTCTGGTCCCGCCACCATCCGCCTCTTCTTCCACG
ACTGCTTCGTCGAG
GGATGCGACGGGTCAATTCTGATATCAACGAAGCCAGGAAGCAGAGAATTGGCAGAGAAGGAAGCAGAGGATAATAAGGACCTGAGAGCAGAAGGATACGACACCG
TTTTCAAAGCCAAGTCCCTCGTTGAGACCAAGTGCCCCGGCGCCATCTCTTGCTCCGACATCCTCGCCATTGCCGCCCGTGACTATGTCCACTTA
ACAGGTGGACCATACTACCAAGTGA
AGAAAGGAAGATTTGACGGGAAAACATCCAAGGCAACAAAAGTACCTGACAACATTCCACGGTCAAATTCGACCGTCGACGCCCTCCTTACCCTCTTCCGAACCAAAGGCCTGTCACTTC
AAGACATGGTGGTCCTATCCGGAGCACATACGATTGGATTCGCACACTGCAAGCAATTCGTCACCAGGCTGTACGACTACAAGGGCACAAAAAACCCCGACCCCACCCTGGACCCGAGGC
TACTGAAGGAACTAAGAATTTCATGCCCTAGGGTCGGGTCGAATGATAAGGTAGTGGTGCCGTTCGATGTCACGACGCCGTTTAAGTTCGATCATGCTTACTACTTGAACTTGGAAGGGA
AGTTGGGCCTGCTGGGCTCGGATCAGGGCCTGTGGATGGATCCGAGGACCAAGGGTGTGGTCCAGGAGATGGGGAGGGATAGAGGCAAGTTTTTTGGGATGTTTGGTTTGGCTATGGAGA
AGATGGGGGAGATTGGTGTTAAGAGTGGGAGGAGACATGGTGAGATTAGGAGAGATTGTAGTATGGTTAATTGA

Retrieve as FASTA