Entry information : LuPrx82(Lus10015074|PACid:23171495)
Entry ID 12185
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx82(Lus10015074|PACid:23171495)
Name LuPrx82(Lus10015074|PACid:23171495)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx82
start..stop
S start..stop
PtPrx08 521 0 23..327 25..329
PtrePrx03 513 0 15..327 6..328
PpePrx66 507 0 27..329 25..327
CclPrx33 507 0 23..328 25..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 374195..374273 79 N° 2 373954..374102 149 N° 3 373650..373838 189 N° 4 372983..373555 573
complement(join(372983..373555,373650..373838,373954..374102,374195..374273))


exon

Literature and cross-references LuPrx82(Lus10015074|PACid:23171495)
DNA ref. Phytozome 12:   scaffold54 (374273..372983)
Protein sequence: LuPrx82(Lus10015074|PACid:23171495)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (308)
PWM (Da):   %s   36128.06 (33865.9)  
PI (pH):   %s   7.47 (7.50) Peptide Signal:   %s   cut: 22 range:22-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAAGAANIFTSLFVLYFCLATQFHSGKSQLQSNYYEQSCPRAEAIVKEQVIKLYHQHGNTAVSWLRNLFHDCVVKSCDASLLLESVNGIQSEKNSGRSFGMRNFKYVTTIKHALEAECPSTVSCADIVALSARDGIVMLGGPRMELKTGRKDSKQSYLAEVESSIPNHNDSISAVLTRFQSMGIDVEGTVALLGAHSVGRVHCVNLVGRLYPAVDPALDPVYASYLKARCPSPNPDPNAVLYSRNDRETPMILDNMYYKGLLKNKGLLSVDQQLATDPRTAPFVGRMAADNDYFHEQFARAVVLLSENNPVTGSDGEVRKDCRYVNVS*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCGCCGGCGCCGCAAACATTTTCACATCACTCTTCGTTCTCTACTTCTGCCTCGCCACTCAGTTCCACTCTGGTAATTATTTAATATAACTGAATTTCTCTACTTTCTAACAA
TTAATAAAAATCCAGCCCATATAATCTTAATTCGTGTTTGTTTTACTGAAGGGAAAAGCCAGCTCCAGTCGAACTACTACGAACAGAGCTGCCCAAGAGCTGAAGCCATCGTGAAAGAGC
AAGTCATCAAGCTTTACCATCAACATGGAAACACCGCCGTCTCTTGGCTCCGCAACCTCTTCCACGACTGCGTCGTCAAG
GTACCTACCTACATGCCATCATTTAATTAATTGTTACATG
CTCCTTTGAATTGGAAATTCTATTCTACGCTAATTAACATGTTCCATAATTTGATCAATTTGATCGATTGAGCAGTCTTGCGACGCTTCTCTGTTACTCGAATCGGTGAATGGAATCCAA
TCGGAGAAGAACTCCGGCAGGAGCTTTGGTATGAGGAATTTCAAATACGTCACCACCATCAAACACGCTCTCGAGGCCGAGTGCCCTTCCACCGTTTCCTGCGCCGACATCGTCGCTCTC
TCTGCCCGTGACGGGATTGTTATG
GTAAAAAGAAAAAGTCTAATATCTCACCAATTTTGTTTATCACGCACAAATGTTACCTTACGAAAATATATATCAATTTTTACCGTAATTACAGCT
AGGAGGCCCTAGAATGGAGCTGAAAACAGGGCGAAAGGACAGCAAGCAGAGCTACTTAGCAGAAGTAGAAAGCTCCATCCCAAACCACAACGACTCTATCTCTGCCGTACTCACCCGATT
TCAATCCATGGGCATCGACGTAGAAGGCACCGTCGCTCTCTTGGGGGCCCACTCGGTGGGCCGGGTCCACTGCGTCAACTTGGTGGGCCGACTCTATCCCGCCGTGGACCCGGCTCTGGA
CCCGGTCTACGCTAGCTACCTAAAGGCCCGTTGCCCGAGCCCCAACCCGGACCCAAATGCGGTCTTGTACTCAAGGAACGACCGTGAGACGCCGATGATTCTGGACAATATGTACTACAA
GGGCCTGCTGAAGAACAAGGGGCTGCTCTCCGTGGACCAACAGCTGGCTACTGATCCTCGTACGGCACCGTTTGTGGGGAGGATGGCTGCTGATAATGACTACTTCCACGAGCAGTTCGC
TAGAGCGGTGGTTTTGCTGTCGGAGAACAATCCGGTCACGGGCAGTGATGGAGAGGTGAGAAAGGATTGCCGGTATGTGAATGTCAGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGCCGCCGGCGCCGCAAACATTTTCACATCACTCTTCGTTCTCTACTTCTGCCTCGCCACTCAGTTCCACTCTGGGAAAAGCCAGCTCCAGTCGAACTACTACGAACAGAGCTGC
CCAAGAGCTGAAGCCATCGTGAAAGAGCAAGTCATCAAGCTTTACCATCAACATGGAAACACCGCCGTCTCTTGGCTCCGCAACCTCTTCCACGACTGCGTCGTCAAG
TCTTGCGACGCT
TCTCTGTTACTCGAATCGGTGAATGGAATCCAATCGGAGAAGAACTCCGGCAGGAGCTTTGGTATGAGGAATTTCAAATACGTCACCACCATCAAACACGCTCTCGAGGCCGAGTGCCCT
TCCACCGTTTCCTGCGCCGACATCGTCGCTCTCTCTGCCCGTGACGGGATTGTTATG
CTAGGAGGCCCTAGAATGGAGCTGAAAACAGGGCGAAAGGACAGCAAGCAGAGCTACTTAGCA
GAAGTAGAAAGCTCCATCCCAAACCACAACGACTCTATCTCTGCCGTACTCACCCGATTTCAATCCATGGGCATCGACGTAGAAGGCACCGTCGCTCTCTTGGGGGCCCACTCGGTGGGC
CGGGTCCACTGCGTCAACTTGGTGGGCCGACTCTATCCCGCCGTGGACCCGGCTCTGGACCCGGTCTACGCTAGCTACCTAAAGGCCCGTTGCCCGAGCCCCAACCCGGACCCAAATGCG
GTCTTGTACTCAAGGAACGACCGTGAGACGCCGATGATTCTGGACAATATGTACTACAAGGGCCTGCTGAAGAACAAGGGGCTGCTCTCCGTGGACCAACAGCTGGCTACTGATCCTCGT
ACGGCACCGTTTGTGGGGAGGATGGCTGCTGATAATGACTACTTCCACGAGCAGTTCGCTAGAGCGGTGGTTTTGCTGTCGGAGAACAATCCGGTCACGGGCAGTGATGGAGAGGTGAGA
AAGGATTGCCGGTATGTGAATGTCAGTTAA

Retrieve as FASTA