Entry information : LuPrx85(Lus10015555|PACid:23173649)
Entry ID 12187
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuPrx85(Lus10015555|PACid:23173649)
Name LuPrx85(Lus10015555|PACid:23173649)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuPrx85
start..stop
S start..stop
RcPrx09 486 1e-174 7..330 6..321
CsPrx29 481 8e-173 10..330 1..314
CclPrx45 481 8e-173 10..330 9..322
GmPrx79 480 2e-172 11..330 9..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 549832..550059 228 N° 2 550152..550331 180 N° 3 550438..550600 163 N° 4 550678..551099 422
join(549832..550059,550152..550331,550438..550600,550678..551099)


exon

Literature and cross-references LuPrx85(Lus10015555|PACid:23173649)
DNA ref. Phytozome 12:   scaffold860 (549832..551099)
Protein sequence: LuPrx85(Lus10015555|PACid:23173649)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (301)
PWM (Da):   %s   35849.18 (32369.6)  
PI (pH):   %s   8.32 (8.39) Peptide Signal:   %s   cut: 30 range:30-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPMSSFVPLMILFMACYWTWTRTTTVEAQLTNGFYSSSCPKAEAIVKSAVESAFQKDPSVAPGLLRLHFHDCFVQGCDGSVLITGANAERSAVPNLGLKGFQVIDDAKTQLEASCPGVVSCADILALAARDSVVLSGGPTWTVQTGRRDGRVSSISQVASLPSPLDSITTQKQKFASKNLDDHDLVTLVGAHTIGQTHCKLINYRLYNFTSKGNADPTINQSFLTQLRTLCPNGGDELKKVALDKDTPAKFDVEFFKNVKGGNGVLESDQRLMDDPNTRRIVENYAGPIKGLLGLRFDFEFRKSMTKMGSIEVKTGSVGEVRKVCSKFN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACCCATGTCGTCGTTTGTCCCTCTGATGATTTTGTTCATGGCATGTTACTGGACTTGGACAAGAACAACAACAGTAGAAGCCCAGTTGACAAATGGGTTTTACTCCTCTTCCTGC
CCAAAGGCTGAAGCCATTGTCAAGTCCGCCGTGGAATCAGCCTTTCAGAAAGATCCATCAGTTGCCCCTGGATTGCTTAGGCTTCATTTCCACGACTGCTTCGTTCAG
GTTATTATTAAT
TGCTGATCTAACTCCGCAAGCTTTCATGCCTATACATAGCTAGTTAATACTAATATTTGGAATTTTGTTGTACTGCTCAGGGCTGCGATGGTTCAGTGTTGATTACAGGTGCTAATGCTG
AAAGAAGTGCAGTTCCCAACTTAGGATTGAAAGGCTTTCAAGTCATAGATGATGCTAAGACACAGTTAGAGGCATCCTGCCCCGGTGTCGTCTCTTGCGCCGATATCCTTGCCTTGGCTG
CCCGCGATTCCGTCGTTCTG
GTATGTCTTTTCATATTTTAAACAGTTCTGTTCATGTTCACTGAATCAGATTCCAAAATTTTCATGGCTAATTCTAATATTTTGTTGCGTTTTTCTATTT
TCGTAGAGTGGCGGTCCAACCTGGACAGTCCAAACTGGGAGAAGAGATGGAAGAGTATCATCAATCTCCCAAGTAGCAAGTTTACCTTCACCATTAGATTCAATCACTACCCAGAAGCAA
AAATTCGCTTCTAAAAACCTTGATGACCACGATCTCGTCACCTTAGTTG
GTAATATAATTGAGCAGCATTTACTTTCAAACCTTACTTGTTCATTACATATAATCAATATATGTACGTAC
GTACAGGGGCGCATACAATTGGGCAAACACACTGCAAGTTGATCAACTACCGTCTCTACAACTTCACATCGAAGGGAAATGCAGACCCAACGATCAACCAATCTTTCCTAACACAGCTTC
GGACACTTTGTCCGAATGGCGGCGATGAGCTGAAGAAGGTTGCATTGGACAAGGACACTCCGGCGAAATTCGACGTTGAGTTCTTCAAGAATGTGAAGGGTGGGAATGGGGTGTTGGAAT
CGGACCAGAGGCTTATGGACGACCCAAATACTCGAAGGATCGTGGAGAATTATGCAGGGCCAATAAAAGGACTACTCGGATTACGGTTCGATTTCGAATTCAGAAAGTCCATGACTAAGA
TGGGTAGCATTGAAGTGAAGACAGGGAGCGTTGGGGAGGTTAGGAAAGTTTGTTCCAAGTTCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACCCATGTCGTCGTTTGTCCCTCTGATGATTTTGTTCATGGCATGTTACTGGACTTGGACAAGAACAACAACAGTAGAAGCCCAGTTGACAAATGGGTTTTACTCCTCTTCCTGC
CCAAAGGCTGAAGCCATTGTCAAGTCCGCCGTGGAATCAGCCTTTCAGAAAGATCCATCAGTTGCCCCTGGATTGCTTAGGCTTCATTTCCACGACTGCTTCGTTCAG
GGCTGCGATGGT
TCAGTGTTGATTACAGGTGCTAATGCTGAAAGAAGTGCAGTTCCCAACTTAGGATTGAAAGGCTTTCAAGTCATAGATGATGCTAAGACACAGTTAGAGGCATCCTGCCCCGGTGTCGTC
TCTTGCGCCGATATCCTTGCCTTGGCTGCCCGCGATTCCGTCGTTCTG
AGTGGCGGTCCAACCTGGACAGTCCAAACTGGGAGAAGAGATGGAAGAGTATCATCAATCTCCCAAGTAGCA
AGTTTACCTTCACCATTAGATTCAATCACTACCCAGAAGCAAAAATTCGCTTCTAAAAACCTTGATGACCACGATCTCGTCACCTTAGTTG
GGGCGCATACAATTGGGCAAACACACTGC
AAGTTGATCAACTACCGTCTCTACAACTTCACATCGAAGGGAAATGCAGACCCAACGATCAACCAATCTTTCCTAACACAGCTTCGGACACTTTGTCCGAATGGCGGCGATGAGCTGAAG
AAGGTTGCATTGGACAAGGACACTCCGGCGAAATTCGACGTTGAGTTCTTCAAGAATGTGAAGGGTGGGAATGGGGTGTTGGAATCGGACCAGAGGCTTATGGACGACCCAAATACTCGA
AGGATCGTGGAGAATTATGCAGGGCCAATAAAAGGACTACTCGGATTACGGTTCGATTTCGAATTCAGAAAGTCCATGACTAAGATGGGTAGCATTGAAGTGAAGACAGGGAGCGTTGGG
GAGGTTAGGAAAGTTTGTTCCAAGTTCAATTGA

Retrieve as FASTA