Entry information : LuRboh132(Lus10024683|PACid:23161549)
Entry ID 12200
Creation 2013-05-28 (Qiang Li)
Last sequence changes 2013-05-29 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Qiang LI)
Peroxidase information: LuRboh132(Lus10024683|PACid:23161549)
Name LuRboh132(Lus10024683|PACid:23161549)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh009]
Taxonomy Eukaryota Viridiplantae Streptophyta Linaceae Linum
Organism Linum usitatissimum (flax)    [TaxId: 4006 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LuRboh132
start..stop
S start..stop
CsRboh01 1391 0 3..892 7..946
CclRboh01 1388 0 3..892 7..946
CarRboh05 1312 0 2..892 6..946
LuRboh159 1307 0 1..892 1..931
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 757844..758543 700 N° 2 758646..758805 160 N° 3 759005..759053 49 N° 4 759711..759824 114
N° 5 760666..761088 423 N° 6 761417..761605 189 N° 7 761881..761976 96 N° 8 762066..762181 116
N° 9 762282..762449 168 N° 10 762534..762693 160 N° 11 762797..762982 186 N° 12 763090..763297 208
N° 13 763398..763507 110  
join(757844..758543,758646..758805,759005..759053,759711..759824,760666..761088, 761417..761605,761881..761976,762066..762181,762282..762449,762534..762693,76279 7..762982,763090..763297,763398..763507)


exon

Literature and cross-references LuRboh132(Lus10024683|PACid:23161549)
DNA ref. Phytozome 12:   scaffold349 (757844..763507)
Protein sequence: LuRboh132(Lus10024683|PACid:23161549)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   892
PWM (Da):   %s   100861.55 Transmb domain:   %s   o400-419i536-558o
PI (pH):   %s   9.46
Sequence 934
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKHERRWRSDSLPGKGRAADSSSSSSAGTSPASDARSSTAAATEDFVEVTLDLQDDDTIILRSVEPATVINIGGEEGDHESGGSELLPRSTPTSAPTSRSPTIKRSSSNKLRQFSQELKADAVAKARQFSLDVRAELRRFSRSRGGTASRNNNPENNNNGGAVFESALAARALRKQRAQLDRTRTSAHKALRGLKFISKRKSQGVEAWNEVASNFDKLAVDGYLQRADFAQCIGMRDSKEFALELFDGLSRRRRLKVEKLSKEELYEFWAQITDDSFDSRLQIFFDMVDKNEDGRLTEEDVKEIIMLSASANKLSRLKEQAEEYAALIMEELDPEGLGYIELWQLETLLLQKDTYQNYSQAMSYTSQALSQNLQGLRMRSPIRRMSTNFVYFLEMNWKRIWVISLWIMIMIGLFAWKFYQYKQKAAFNVMGYCLLTAKGAAETLKFNMALILLPVCRNTITRLRSTRLAYVFPFDDNINFHKTIAAAIVVGVILHVGNHLACDFPRLESASAHDYDLYLRKDFGDHKPSYMKLVRGVEGVTGILMTWMYLSVPVLLYAGERALRFFRSGSHSVRLLKVAIYPGNVLTLQMSKPTQFRYKSGQYMFVQCPAVSPFEWHPFSITSAPGDDYLSVHIRQLGDWTQELKRVFSEVCERPISGKSGLLRADETTKRSLPKLLIDGPYGAPAQDYKKYDVLLLVGLGIGATPFISILKDLLNNIVKMEEMADSVADSSRGSDQLSFTSTTDFMRRKKALIKTTNAYFYWVTREQGSFDWFKGVMNEIADLDQRGVLEMHNYLTSVYEEGDARSTLITMVQALNHAKNGVDIVSGTRVRTHFARPNWKKVLSKLSSKHCNARIGVFYCGAPVLANELGKLCYEFNQKGSTKFEFHKEHF*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAGCACGAGAGGCGATGGCGATCGGATTCCTTACCTGGAAAGGGCAGAGCAGCTGACAGCAGTAGCAGCAGCAGCGCGGGGACTTCTCCGGCGAGCGATGCGAGAAGCTCGACAGCGG
CAGCGACGGAGGATTTCGTCGAGGTCACGCTCGATTTGCAGGACGACGATACGATTATACTCCGAAGCGTTGAGCCGGCGACGGTGATCAATATCGGCGGAGAGGAAGGCGATCACGAGA
GCGGCGGAAGCGAGCTGTTACCTCGTTCGACTCCTACTTCCGCTCCGACTTCCAGATCTCCTACGATCAAGCGAAGCTCGTCAAACAAGCTGCGGCAGTTCTCGCAGGAGCTGAAGGCGG
ATGCAGTGGCGAAGGCGAGACAATTCTCGCTGGATGTGAGAGCTGAGCTACGTAGGTTCTCGAGGAGCCGCGGAGGAACAGCGTCGCGTAATAATAATCCGGAGAACAACAACAATGGCG
GTGCTGTATTTGAGTCCGCGTTGGCTGCTCGAGCTCTGAGGAAGCAGCGAGCTCAGCTCGATCGGACCAGGACCAGCGCTCACAAAGCCCTGCGGGGTCTCAAGTTCATCAGTAAGAGGA
AATCTCAAGGCGTCGAGGCGTGGAATGAAGTGGCCAGCAACTTCGATAAGCTCGCCGTGGACGGTTATCTCCAACGCGCAGATTTCGCGCAATGCATAG
GTTAGTTTTTAAATCCCTAAT
CACGTCGACATTTCAGTTTTTTTCAATTCGATTTGGATAATTTCGTCTGGTGAATTGATTTTGTAAAGTTCTCCCCTGTAGGGATGAGAGACTCTAAAGAGTTTGCACTCGAACTGTTCG
ACGGATTGAGCAGGAGAAGGAGGTTGAAGGTTGAGAAGCTTAGCAAGGAGGAGTTGTACGAATTCTGGGCACAAATCACCGATGACAGCTTCGACTCACGGCTTCAGATCTTCTTCGACA
T
GTATGCAGAAAAGCACAAACCAATGATGATTGATCAATTTAGACTAGTTGATCGCCTCCTTAATTAATTAATTAGTCAATACTGATTTGGTATTAGCCGTTTGACAAGACAAAATCGTC
CTTTCTGACGTGTCCATTTCTTATTGCTCTACGTTTCGGATGCTTGTGAGTTTTCCTAACAGTAATGCTTATTGTAACAGGGTGGACAAGAATGAAGATGGTAGACTCACAGAGGAAGAC
GTAAAAGAG
GTACCTGCAGTTTCTTGTTTATCTTATCAATTCTTGTATAATAATCATTGAAAGAATCAGTCTACATTACTGTTGTGATTTTCATGGTTAACTTAAAGGTCTAAGCCTAGA
GTCGTGAATTAGTCAATTAGGCACCACTACCCTGTCAATTGCTTGAGGAAGAAACTAACTCATCAATATTTTAACCAGCCATTTTAGCAGCCGTCTATCCCCACAGAAGTGTCGTAGGAC
TTTTTTATAAAGTAAGCAATTTGGCTTTATTATTGATATCTTACTGAAGAGGGTAGGCTTGAAATTTGCATCAAATTTAAATTCCCAGGACTAACTGCTCCATTACTGCAATGAAACCAT
ATTGTGTTGTTTCCACGATTCGTTTGTTTATCAAACGATTCCATTATATATAGTGACGTTCCCTATATTCTGACTTCTGAAATATTATCTTTGAATTGTTGGACTGGATCTACTCCTCTT
AGTAAAAGGGGTTTGGAATTGGGTTGACAACGTTTGGCATTTTTTTATGTTCCAACTTCCGAACGTAGCGTCAGGAAGTTTACATGTCATTTTGTTGTTTGGGTTAGGTAGGAGGCTTTA
TTCGTTCTTGTGTTTTTACCTTTTTTCTTACTAATTACTGACTTTCTATTCTCTGTACTTTTATAGATTATTATGTTAAGTGCTTCGGCGAATAAACTATCAAGATTGAAGGAACAAGCG
GAAGAATATGCAGCTTTGATCATGGAAGAGTTGGACCCTGAAGGACTTGGCTACATCGAG
GTGGGTCCTAGTCCTACATTTATGTGTTCACTTACGTTGATTCTTGTGCTAGAAGCAATA
GCGTTAAACTGCATTGACATATAATTATAAGTCTTAAACAAGAATATTATTCAAGTAAGGAGTCATTTTCAGTCTAGTTTTCACATACTAGTTAACTGCTCTTTGCGGGGAGGTTGTTAG
GCTAAATACATGTTTAATGAAAGCCAAGTCTGACCATTCTTTAGATTCTTAATCAATTACCAAACAAGAATCGGTTACAACATTTCTATCATGATGCTTCTTCTTTCAAAGTCCATGAAT
TGTTAGGCAAAAAACAATGAGATAGATAAGTCATCGAGAATTGGGGTTGTGATGTTGTTCAACTGTGAACGAAGAAAAAAAAGATGATGAAACAAGTGGAGAAGGATCATTAATTTGGTT
AAGTAAACTTATCTAAGTGGATTTCTCGTTGTCGGTGGTTCAACAGCTTTCCTAGTTGTTGCTTATTTTTCCATCTTTCCGCCTTCCCATAACCTGCTCTACTATTTTTAGTTGATTGTC
ATGTTATTGTGGCATGATTAGCTAGTGAACAGTATATAAAATATTAGCATACGCTAGTGACATAACATGGTCTGTCAAATTGTCAATTGGGTATGGAGGGAAATCTAGCTAGAGAGTAAA
TGCCATTGATTGTTGAGAAATTCTTGCGACTCATAAAACATAATTGAACAAAAATACTGATCACATCATAGCTTCAGTACTTTTGGAGAGAAAATCGTTTCATCTCCAGTACTTTTACTG
GCCTAGTTGCAGTGACCGAGAGATACCATACCATAGTCCTAAGTTGATAATGATACTGCAGCTATGGCAACTGGAGACGCTTCTTCTACAAAAGGACACATATCAAAACTACAGTCAAGC
AATGAGCTACACAAGCCAAGCCTTGAGCCAGAACTTGCAAGGGCTAAGAATGAGAAGCCCAATAAGGAGGATGAGCACAAACTTTGTCTACTTCTTGGAAATGAACTGGAAGAGGATCTG
GGTGATATCCTTATGGATCATGATCATGATTGGACTGTTCGCATGGAAATTCTATCAGTATAAGCAGAAAGCTGCCTTCAATGTCATGGGTTACTGTCTCCTGACGGCAAAGGGTGCTGC
GGAAACTCTGAAGTTCAACATGGCCCTCATTCTGCTTCCCGTGTGTAGAAACACCATCACTCGGCTCAGGTCCACACGTCTGGCTTATGTTTTCCCTTTCGATGACAACATAAACTTCCA
CAAG
GTACATTTTCCTAATTTCACCAACCCCCTTTTCTTCCGTTAGTCTTGCTGAAACTGCTTTACTTGTTTAGTACGTTAATCAAGTGGGGTCATATCATGGAGACTTTATTAGACAGT
ACTATGATGGTTGATCTTATATCCGTGTAGTTCGATGATGTTACTGTTCCAAAAGTTAGTGATCACTTTATTCCAAGGAAGAAAGACAAAAAGGAAAAGCTTGCTCAGTTAATTTTACGA
CTTCTTAGGCTAAACAGATAGAACAATCAGTATATTGCATCGAAACAGGCATTGACAAAACTGTACTTGGCGTTCTTCCTTTATGTCTGCAGACTATTGCGGCAGCAATCGTAGTTGGCG
TCATCCTTCACGTTGGAAACCACCTTGCCTGTGATTTCCCGAGGCTCGAAAGCGCTTCTGCCCATGACTACGATCTGTATCTCAGAAAAGACTTCGGAGACCATAAACCCAGTTACATGA
AATTAGTTAGGGGGGTAGAGGGCGTGACTGGAATCCTGATG
GTAATTTTCATGGCAATTGCATTCACCCTGGCAACGAGATGGTTCAGGCGTAACCTCATTAAGTTTCCCAAACCGTTTG
ACAGAATCACTGGGTTCAATGCCTTCTGGTATTCACACCACTTATTTGTCCTCGTCTATATATTGCTGGTCGTCCATGGTATATTCCTCTACCTGGTTCATCACTGGTATAAGAAAACGG
TAAGGTTCCCAATATTGCTTCCTTCCCTTTCAATAGATTCATCGTTCCATTTAGGACGTTTTTACATTCCCGGCAGACATGGATGTACCTCTCTGTTCCTGTGCTGCTTTACGCCGGAGA
AAGAGCCCTCAGGTTCTTCCGCTCTGGCTCCCATTCAGTCCGGCTTTTGAAG
GTTAGTTAGCAGCCTATTAATAGTGTTATATGATTGCCCAAAGGATCTGTCTATAAGCTATTTACCAT
TGTTGATATATGCGTTTCCAGGTTGCAATTTACCCTGGCAACGTACTCACATTGCAAATGTCAAAGCCTACTCAATTCCGGTACAAGAGCGGGCAGTACATGTTCGTTCAGTGCCCTGCT
GTTTCTCCATTTGAATG
GTAAAATACTCTGCTTTTTCTTCTGTTGCCTTTTTTCTCTTCTCTTGTTCTGTCATAATCTTAAGACTTATATCTGATTCAATTATCAATTTCTCCCCAGGCA
CCCATTCTCGATAACTTCAGCTCCTGGAGATGACTACCTTAGCGTCCATATCCGACAGCTAGGCGATTGGACACAAGAACTGAAAAGGGTATTCTCTGAGGTCTGCGAGCGTCCTATTTC
TGGCAAAAGTGGCCTTCTTAGAGCTGATGAAACCACCAAGAGAAG
GTGATTAGCTGAATCTGGTCAACATTTCCTTTCTTTATTTTTCTCTGCACAATGGTGAATCATTTGCTATGTCCG
ATTATACAGTTTGCCGAAGCTGTTAATAGATGGGCCGTACGGTGCCCCAGCGCAAGACTACAAGAAATACGACGTCTTGTTACTCGTAGGGTTGGGTATCGGAGCAACGCCTTTCATCAG
CATTCTCAAAGACTTGCTTAACAACATCGTCAAGATGGAGGAGATGGCT
GTAAGTAAACTACACTAGAAAAGGAAATAAGAAAAAAATGGACTGAATCTGTTTCCATTCCAACTAACATT
CATAGCCACATTAATTCTTCATGTTTGTGCAGGATTCCGTAGCGGACTCCAGCAGAGGTTCAGATCAGCTGAGCTTCACGAGCACCACCGACTTTATGAGACGGAAGAAGGCATTGATAA
AAACCACAAACGCTTACTTCTACTGGGTAACAAGGGAACAAGGCTCATTCGATTGGTTCAAAGGCGTGATGAACGAGATTGCCGACCTTGATCAGAGG
GTACGTAAGAATTAGTACATAA
CACACACAAATGCTGCTATACCTTAGTCATTGGATTTGGCTACTTACCTGAGAAAAGAATGGAATTGGTGTGTTAATCAATCCAGGGGGTACTTGAGATGCACAACTACTTAACCAGCGT
ATACGAGGAAGGGGACGCGAGATCGACTCTGATAACGATGGTGCAAGCATTGAACCATGCCAAAAACGGAGTGGACATTGTCTCGGGGACTAGGGTGCGAACTCATTTCGCGAGGCCTAA
CTGGAAGAAGGTGCTCTCAAAACTAAGCTCAAAGCACTGTAATGCAAGGATAG
GTAAACGCATCAATCTCTTTTTTCCTCTATATACTTCCCCAGTTAGTCATGTTTGATCTGAAAAGGG
TTTTGATTATTGATGTTCTGGTGGGGAATGCAGGGGTATTCTACTGTGGGGCACCAGTTCTGGCCAACGAACTCGGAAAGCTATGCTACGAGTTCAACCAGAAGGGTTCTACCAAGTTCG
AATTCCACAAGGAGCATTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAGCACGAGAGGCGATGGCGATCGGATTCCTTACCTGGAAAGGGCAGAGCAGCTGACAGCAGTAGCAGCAGCAGCGCGGGGACTTCTCCGGCGAGCGATGCGAGAAGCTCGACAGCGG
CAGCGACGGAGGATTTCGTCGAGGTCACGCTCGATTTGCAGGACGACGATACGATTATACTCCGAAGCGTTGAGCCGGCGACGGTGATCAATATCGGCGGAGAGGAAGGCGATCACGAGA
GCGGCGGAAGCGAGCTGTTACCTCGTTCGACTCCTACTTCCGCTCCGACTTCCAGATCTCCTACGATCAAGCGAAGCTCGTCAAACAAGCTGCGGCAGTTCTCGCAGGAGCTGAAGGCGG
ATGCAGTGGCGAAGGCGAGACAATTCTCGCTGGATGTGAGAGCTGAGCTACGTAGGTTCTCGAGGAGCCGCGGAGGAACAGCGTCGCGTAATAATAATCCGGAGAACAACAACAATGGCG
GTGCTGTATTTGAGTCCGCGTTGGCTGCTCGAGCTCTGAGGAAGCAGCGAGCTCAGCTCGATCGGACCAGGACCAGCGCTCACAAAGCCCTGCGGGGTCTCAAGTTCATCAGTAAGAGGA
AATCTCAAGGCGTCGAGGCGTGGAATGAAGTGGCCAGCAACTTCGATAAGCTCGCCGTGGACGGTTATCTCCAACGCGCAGATTTCGCGCAATGCATAG
GGATGAGAGACTCTAAAGAGT
TTGCACTCGAACTGTTCGACGGATTGAGCAGGAGAAGGAGGTTGAAGGTTGAGAAGCTTAGCAAGGAGGAGTTGTACGAATTCTGGGCACAAATCACCGATGACAGCTTCGACTCACGGC
TTCAGATCTTCTTCGACAT
GGTGGACAAGAATGAAGATGGTAGACTCACAGAGGAAGACGTAAAAGAGATTATTATGTTAAGTGCTTCGGCGAATAAACTATCAAGATTGAAGGAACAAG
CGGAAGAATATGCAGCTTTGATCATGGAAGAGTTGGACCCTGAAGGACTTGGCTACATCGAG
CTATGGCAACTGGAGACGCTTCTTCTACAAAAGGACACATATCAAAACTACAGTCAAG
CAATGAGCTACACAAGCCAAGCCTTGAGCCAGAACTTGCAAGGGCTAAGAATGAGAAGCCCAATAAGGAGGATGAGCACAAACTTTGTCTACTTCTTGGAAATGAACTGGAAGAGGATCT
GGGTGATATCCTTATGGATCATGATCATGATTGGACTGTTCGCATGGAAATTCTATCAGTATAAGCAGAAAGCTGCCTTCAATGTCATGGGTTACTGTCTCCTGACGGCAAAGGGTGCTG
CGGAAACTCTGAAGTTCAACATGGCCCTCATTCTGCTTCCCGTGTGTAGAAACACCATCACTCGGCTCAGGTCCACACGTCTGGCTTATGTTTTCCCTTTCGATGACAACATAAACTTCC
ACAAG
ACTATTGCGGCAGCAATCGTAGTTGGCGTCATCCTTCACGTTGGAAACCACCTTGCCTGTGATTTCCCGAGGCTCGAAAGCGCTTCTGCCCATGACTACGATCTGTATCTCAGAA
AAGACTTCGGAGACCATAAACCCAGTTACATGAAATTAGTTAGGGGGGTAGAGGGCGTGACTGGAATCCTGATG
ACATGGATGTACCTCTCTGTTCCTGTGCTGCTTTACGCCGGAGAAA
GAGCCCTCAGGTTCTTCCGCTCTGGCTCCCATTCAGTCCGGCTTTTGAAG
GTTGCAATTTACCCTGGCAACGTACTCACATTGCAAATGTCAAAGCCTACTCAATTCCGGTACAAGAGCG
GGCAGTACATGTTCGTTCAGTGCCCTGCTGTTTCTCCATTTGAATG
GCACCCATTCTCGATAACTTCAGCTCCTGGAGATGACTACCTTAGCGTCCATATCCGACAGCTAGGCGATTGGA
CACAAGAACTGAAAAGGGTATTCTCTGAGGTCTGCGAGCGTCCTATTTCTGGCAAAAGTGGCCTTCTTAGAGCTGATGAAACCACCAAGAGAAG
TTTGCCGAAGCTGTTAATAGATGGGC
CGTACGGTGCCCCAGCGCAAGACTACAAGAAATACGACGTCTTGTTACTCGTAGGGTTGGGTATCGGAGCAACGCCTTTCATCAGCATTCTCAAAGACTTGCTTAACAACATCGTCAAGA
TGGAGGAGATGGCT
GATTCCGTAGCGGACTCCAGCAGAGGTTCAGATCAGCTGAGCTTCACGAGCACCACCGACTTTATGAGACGGAAGAAGGCATTGATAAAAACCACAAACGCTTACT
TCTACTGGGTAACAAGGGAACAAGGCTCATTCGATTGGTTCAAAGGCGTGATGAACGAGATTGCCGACCTTGATCAGAGG
GGGGTACTTGAGATGCACAACTACTTAACCAGCGTATACG
AGGAAGGGGACGCGAGATCGACTCTGATAACGATGGTGCAAGCATTGAACCATGCCAAAAACGGAGTGGACATTGTCTCGGGGACTAGGGTGCGAACTCATTTCGCGAGGCCTAACTGGA
AGAAGGTGCTCTCAAAACTAAGCTCAAAGCACTGTAATGCAAGGATAG
GGGTATTCTACTGTGGGGCACCAGTTCTGGCCAACGAACTCGGAAAGCTATGCTACGAGTTCAACCAGAAGG
GTTCTACCAAGTTCGAATTCCACAAGGAGCATTTCTAG

Retrieve as FASTA