Entry information : PanHalPrx03
Entry ID 12212
Creation 2013-05-30 (Christophe Dunand)
Last sequence changes 2013-05-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-05-30 (Christophe Dunand)
Peroxidase information: PanHalPrx03
Name PanHalPrx03
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Lasiosphaeriaceae Podospora
Organism Podospora anserina    [TaxId: 5145 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PanHalPrx03
start..stop
S start..stop
AniHalPrx04 260 4e-87 6..248 13..257
AniHalPrx04_FGSC26 223 2e-72 6..216 13..222
PnoHalPrx04 197 5e-63 6..244 7..239
PnoHalPrx05 167 9e-51 22..242 44..263
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2637127..2637745 619 N° 2 2637812..2637999 188  
join(2637127..2637745,2637812..2637999)


exon

Literature and cross-references PanHalPrx03
Protein ref. UniProtKB:   B2B6C6
DNA ref. GenBank:   CU640366.1 (2637127..2637999)
Protein sequence: PanHalPrx03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   268 (250)
PWM (Da):   %s   30050.46 (28236.4)  
PI (pH):   %s   8.6 (8.32) Peptide Signal:   %s   cut: 19 range:19-268
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLGIRLVSLLAFTGSALAELDFSKWKTRQPGELRAPCPAMNSLANHGFIQRDGKNITVEGLTPVLKEVFHLSHELAFTVSQLGLFTALDPSKGVFTLQDLTDRHNVFEHDASLSREDAKFGGDQSVLHKGQFQKFMDHFKGEKYISFEAAAKARYAMVQDSRKRNPDFTYDVTHRITSYGETIKYLRTIVEPSTGKCPVDWIKILFEQERLPYNEGWRPPTNELSGFSLASEVLELALITPEKLPVDECLGKGKGKGNCKRRRSYLGI

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 1 intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGGGCATTCGCCTGGTATCTCTGCTGGCCTTCACTGGCTCAGCCCTCGCAGAACTCGACTTCTCCAAGTGGAAGACTCGCCAGCCCGGCGAGCTCCGCGCTCCCTGTCCGGCCATG
AACAGTCTTGCCAACCACGGCTTCATCCAGCGTGATGGCAAGAATATCACCGTCGAGGGCCTCACCCCTGTCCTCAAGGAGGTCTTCCATCTCAGTCACGAGCTCGCCTTCACCGTGTCT
CAGCTGGGCCTCTTTACGGCGCTTGACCCATCCAAAGGTGTCTTTACTCTTCAAGACCTCACGGATCGTCACAACGTCTTTGAGCACGATGCTTCCCTGTCTCGCGAAGATGCCAAGTTC
GGCGGTGACCAGTCTGTTCTTCATAAAGGACAGTTCCAAAAGTTCATGGATCACTTCAAGGGAGAAAAGTACATCTCCTTCGAGGCCGCTGCTAAGGCCCGCTATGCCATGGTCCAGGAC
TCGCGCAAGAGAAACCCCGACTTCACCTACGATGTCACGCACCGCATCACCAGCTACGGCGAAACCATCAAGTACCTCCGTACCATTGTCGAGCCCTCTACAGGGAAGTGCCCGGTTGAC
TGGATCAAGATCCTTTTTG
GTAAGTTGCCACCTGTCAGCCCCCATGCATGCCTCTCAGCCCAACCTGCTAACATGTCATCTTCAGAGCAAGAGCGTCTTCCCTACAACGAGGGCTGGAGG
CCCCCTACCAATGAGCTCAGCGGCTTCAGTCTCGCGAGCGAGGTTTTGGAGCTGGCTTTGATCACTCCTGAGAAACTTCCCGTCGATGAGTGCTTGGGCAAGGGCAAGGGTAAAGGAAAC
TGCAAGAGACGGCGCAGCTACCTTGGTATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGGGCATTCGCCTGGTATCTCTGCTGGCCTTCACTGGCTCAGCCCTCGCAGAACTCGACTTCTCCAAGTGGAAGACTCGCCAGCCCGGCGAGCTCCGCGCTCCCTGTCCGGCCATG
AACAGTCTTGCCAACCACGGCTTCATCCAGCGTGATGGCAAGAATATCACCGTCGAGGGCCTCACCCCTGTCCTCAAGGAGGTCTTCCATCTCAGTCACGAGCTCGCCTTCACCGTGTCT
CAGCTGGGCCTCTTTACGGCGCTTGACCCATCCAAAGGTGTCTTTACTCTTCAAGACCTCACGGATCGTCACAACGTCTTTGAGCACGATGCTTCCCTGTCTCGCGAAGATGCCAAGTTC
GGCGGTGACCAGTCTGTTCTTCATAAAGGACAGTTCCAAAAGTTCATGGATCACTTCAAGGGAGAAAAGTACATCTCCTTCGAGGCCGCTGCTAAGGCCCGCTATGCCATGGTCCAGGAC
TCGCGCAAGAGAAACCCCGACTTCACCTACGATGTCACGCACCGCATCACCAGCTACGGCGAAACCATCAAGTACCTCCGTACCATTGTCGAGCCCTCTACAGGGAAGTGCCCGGTTGAC
TGGATCAAGATCCTTTTTG
AGCAAGAGCGTCTTCCCTACAACGAGGGCTGGAGGCCCCCTACCAATGAGCTCAGCGGCTTCAGTCTCGCGAGCGAGGTTTTGGAGCTGGCTTTGATCACT
CCTGAGAAACTTCCCGTCGATGAGTGCTTGGGCAAGGGCAAGGGTAAAGGAAACTGCAAGAGACGGCGCAGCTACCTTGGTATCTAA

Retrieve as FASTA