Entry information : ParcLiP01
Entry ID 12286
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2018-01-18 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-01-18 (Catherine Mathe)
Peroxidase information: ParcLiP01
Name ParcLiP01
Class Lignin peroxidase    [Orthogroup: LiP004]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Polyporaceae Polyporus
Organism Polyporus arcularius    [TaxId: 5639 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ParcLiP01
start..stop
S start..stop
ParcLiP02 682 0 1..364 1..364
ParcLiP05 680 0 1..364 1..364
ParcLiP04 660 0 1..364 1..364
ParcLiP03 656 0 1..364 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 50110..50170 61 N° 2 49714..50053 340 N° 3 49536..49657 122 N° 4 48986..49482 497
N° 5 48867..48931 65 N° 6 48797..48809 13  
complement(join(48797..48809,48867..48931,48986..49482,49536..49657,49714..50053 ,50110..50170))


exon

Literature and cross-references ParcLiP01
DNA ref. JGI genome:   scaffold_167 (50170..48797)
Cluster/Prediction ref. JGI gene:   585896
Protein sequence: ParcLiP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   365 (344)
PWM (Da):   %s   38906.29 (36767.1)  
PI (pH):   %s   4.23 (4.21) Peptide Signal:   %s   cut: 22 range:22-365
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKALLSIVAVVAALQGVDAALTRRVACPDGKNTATNAACCALFPIRDDIVENLFHNQCAEEAHESLRLTFHDAVAFSPAAQARGEFVGGGADGSIVLFSDIETNFHANDGTDDIVALQKPFIAKHNISAADFVQFAGAVGLAQCPGAPQLEFLLGRKDATQPANDGLVPEPFDSVDSILARLLDVGFQDFEVVWLLSAHTVAAADRVDPTIPRTPFDSTPEIFDTQFFIETQLRGQTFPGVGGEQGEVTSPLRGEMRLQSDHLLARDSRTSCEWQSFTNDQEKFSETFPDVMGRLALLGVDQSQLIDCSEVIPIAPPLPASSRPHFPAGKTAADVEQACAETPFPSFPTDPGPATSVAPVPNA*

Retrieve as FASTA  
Remarks complete sequence from genomics (5 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAAGCTCTCCTCTCCATAGTCGCCGTTGTTGCTGCCCTTCAAGGCGTCGACGGTATGCCCATTTTCGGCCGATTTTTCGATAGCCTGCTGTAACACGTTGTTCCACAGCTG
CGCTCACCCGCCGCGTCGCTTGCCCGGACGGCAAGAACACCGCGACGAACGCGGCATGCTGCGCCCTCTTCCCTATCCGGGACGACATCGTCGAGAATCTCTTCCACAACCAGTGCGCTG
AGGAGGCCCACGAGTCCCTCCGCTTGACTTTCCACGACGCCGTCGCCTTCTCGCCCGCGGCGCAGGCTCGGGGTGAGTTTGTCGGCGGAGGCGCTGACGGCTCCATCGTCCTCTTCTCCG
ACATCGAGACGAACTTCCATGCGAACGACGGCACCGACGACATCGTCGCTTTGCAGAAGCCGTTCATCGCCAAGCACAACATCTCTGCCGCTGACTT
GTGCGTACTTTCTGCCCGCCTTG
TGTCTTGTCTCGGATACTAACGTGCAATGGCAGCGTGCAATTTGCGGGTGCCGTCGGGCTCGCTCAGTGCCCCGGTGCACCTCAGCTCGAGTTCCTGCTCGGTCGCAAGGATGCTACTCA
GCCTGCGAATGATGGTCTTGTTCCAGAGCCCTTCG
GTATGCCCCGCTATGCTCCACTGGATCATCTCGATTGCTGACGATGAATTCAGACAGCGTTGACAGCATCCTCGCCCGCCTCCTC
GACGTCGGCTTCCAGGACTTCGAGGTCGTCTGGCTGCTCTCCGCCCACACCGTCGCTGCTGCGGACAGGGTCGACCCCACGATCCCGCGCACGCCCTTCGATTCTACCCCGGAGATCTTC
GACACCCAGTTCTTCATCGAGACTCAGCTCCGCGGGCAGACATTCCCCGGCGTGGGTGGCGAGCAGGGCGAGGTGACGTCCCCACTCCGCGGCGAGATGCGGCTGCAGTCCGACCACCTC
CTCGCACGCGACTCGCGCACCTCGTGCGAGTGGCAGTCTTTCACCAACGACCAGGAGAAGTTTTCCGAGACGTTCCCGGACGTCATGGGTCGCCTTGCGCTCCTCGGCGTGGACCAGAGC
CAGCTCATCGACTGCTCGGAAGTCATCCCCATCGCGCCGCCCCTTCCCGCCAGCTCCCGCCCCCACTTCCCCGCTGGCAAGACTGCTGCTGATGTCGAGCAGGCC
GTGAGTTCCCTGCTT
CCCCTTGGTCGGAATGTTGAACTGACTCAGTTCGTCTAGTGCGCCGAGACCCCCTTCCCGTCCTTCCCCACCGACCCCGGCCCGGCCACCTCTGTTGCGCCCGTGTAAGTCATCTTGGCC
TTACCACTCGGTTGATACCCGTATCTGACTCGAATTTACAGCCCCAATGCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAAGCTCTCCTCTCCATAGTCGCCGTTGTTGCTGCCCTTCAAGGCGTCGACGCTGCGCTCACCCGCCGCGTCGCTTGCCCGGACGGCAAGAACACCGCGACGAACGCGGCA
TGCTGCGCCCTCTTCCCTATCCGGGACGACATCGTCGAGAATCTCTTCCACAACCAGTGCGCTGAGGAGGCCCACGAGTCCCTCCGCTTGACTTTCCACGACGCCGTCGCCTTCTCGCCC
GCGGCGCAGGCTCGGGGTGAGTTTGTCGGCGGAGGCGCTGACGGCTCCATCGTCCTCTTCTCCGACATCGAGACGAACTTCCATGCGAACGACGGCACCGACGACATCGTCGCTTTGCAG
AAGCCGTTCATCGCCAAGCACAACATCTCTGCCGCTGACTT
CGTGCAATTTGCGGGTGCCGTCGGGCTCGCTCAGTGCCCCGGTGCACCTCAGCTCGAGTTCCTGCTCGGTCGCAAGGAT
GCTACTCAGCCTGCGAATGATGGTCTTGTTCCAGAGCCCTTCG
ACAGCGTTGACAGCATCCTCGCCCGCCTCCTCGACGTCGGCTTCCAGGACTTCGAGGTCGTCTGGCTGCTCTCCGCC
CACACCGTCGCTGCTGCGGACAGGGTCGACCCCACGATCCCGCGCACGCCCTTCGATTCTACCCCGGAGATCTTCGACACCCAGTTCTTCATCGAGACTCAGCTCCGCGGGCAGACATTC
CCCGGCGTGGGTGGCGAGCAGGGCGAGGTGACGTCCCCACTCCGCGGCGAGATGCGGCTGCAGTCCGACCACCTCCTCGCACGCGACTCGCGCACCTCGTGCGAGTGGCAGTCTTTCACC
AACGACCAGGAGAAGTTTTCCGAGACGTTCCCGGACGTCATGGGTCGCCTTGCGCTCCTCGGCGTGGACCAGAGCCAGCTCATCGACTGCTCGGAAGTCATCCCCATCGCGCCGCCCCTT
CCCGCCAGCTCCCGCCCCCACTTCCCCGCTGGCAAGACTGCTGCTGATGTCGAGCAGGCC
TGCGCCGAGACCCCCTTCCCGTCCTTCCCCACCGACCCCGGCCCGGCCACCTCTGTTGCG
CCCGT
CCCCAATGCGTGA

Retrieve as FASTA