Entry information : ParcLiP03
Entry ID 12289
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2018-01-25 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-01-25 (Catherine Mathe)
Peroxidase information: ParcLiP03
Name ParcLiP03
Class Lignin peroxidase    [Orthogroup: LiP004]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Polyporaceae Polyporus
Organism Polyporus arcularius    [TaxId: 5639 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ParcLiP03
start..stop
S start..stop
ParcLiP01 676 0 1..364 1..364
ParcLiP02 657 0 1..364 1..364
ParcLiP05 652 0 1..364 1..364
ParcLiP04 635 0 1..364 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 54136..54196 61 N° 2 54258..54597 340 N° 3 54648..54769 122 N° 4 54827..55323 497
N° 5 55378..55442 65 N° 6 55497..55509 13  
join(54136..54196,54258..54597,54648..54769,54827..55323,55378..55442,55497..555 09)


exon

Literature and cross-references ParcLiP03
DNA ref. JGI genome:   scaffold_146 (54136..55509)
Cluster/Prediction ref. JGI gene:   67885
Protein sequence: ParcLiP03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   365 (344)
PWM (Da):   %s   38649.11 (36421.9)  
PI (pH):   %s   3.96 (3.94) Peptide Signal:   %s   cut: 22 range:22-365
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKALLSIVSLVAALQGVDAALTRRVACPDGINTATNAACCALFPIRDDIIENLFHNQCAEEAHESLRLTFHDAVAFSPAAQARGEFGGGGADGSIVLFSDIETNFHANDGTDEIVALQKPFIAKNNISAADFVQFAGAVGLAQCPGAPQLEFLLGRPDATQAAPDGLVPEPFDSVDSILSRLLDVGFQDFEVVWLLSAHTVAAADRVDTTIPRTPFDSTPEIFDTQFFIETQLVGQTFPGVGGAQGEVVSPIPGEMRLQSDFLIARDSRTACEWQSFTNDQEKFAETFPDVMGRLALLGVDQSTLIDCSEVIPIAPPLPDSAIPHFPAGKTAEDVEAACAETPFPSFPTDPGPATSVAPVPNE*

Retrieve as FASTA  
Remarks complete sequence from genomics (5 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGGCTCTCCTCTCCATCGTCTCCCTCGTCGCCGCACTTCAAGGCGTCGACGGTACGCCCATTCGCTCATGTTGCGATGCACTCCTGGCACCTTCTGACATGCTGTCCCAC
AGCTGCGCTCACCCGCCGCGTCGCTTGCCCGGACGGCATCAACACCGCGACCAACGCGGCGTGCTGCGCCCTCTTCCCGATCCGGGACGACATCATCGAGAACCTCTTCCACAACCAGTG
CGCCGAGGAGGCCCACGAGTCCCTCCGCCTGACCTTCCACGACGCCGTCGCCTTCTCGCCCGCTGCGCAGGCTCGGGGCGAGTTCGGCGGTGGCGGCGCCGACGGGTCTATCGTCCTCTT
CTCCGACATAGAGACGAACTTCCACGCGAACGACGGCACCGACGAGATCGTGGCGTTGCAGAAGCCATTCATCGCGAAGAACAACATCTCCGCCGCTGACTT
GTAGGTGTTGTCCTCTCC
TGGTTGCGACCAAGTGCTAACGTCCGCTGCAGCGTCCAGTTTGCGGGAGCCGTCGGGCTTGCTCAGTGCCCTGGTGCACCCCAGCTTGAGTTCTTGCTCGGCCGCCCGGATGCTACGCAG
GCTGCCCCCGACGGTCTCGTCCCTGAGCCCTTCG
GTATGTCTCTCTCCTGTAACGAGTGCCGATCACACTGACACTCACACACGTCTGCAGACAGCGTCGACTCCATCCTATCCCGCCTG
CTCGACGTCGGCTTCCAGGACTTCGAAGTCGTCTGGCTGCTCTCCGCCCACACCGTCGCGGCCGCCGACCGTGTGGACACGACGATCCCGCGCACGCCCTTCGACTCGACCCCGGAGATC
TTCGACACCCAGTTCTTCATCGAGACGCAGCTCGTCGGGCAGACCTTCCCCGGCGTGGGCGGCGCGCAGGGCGAGGTCGTCTCCCCGATCCCGGGCGAGATGCGCCTGCAGTCCGACTTC
CTCATCGCGCGCGACAGCCGCACCGCGTGCGAGTGGCAGTCGTTCACGAACGACCAGGAGAAGTTCGCCGAGACGTTCCCGGACGTCATGGGCCGCCTGGCGCTCCTCGGCGTCGACCAG
AGCACGCTCATCGACTGCTCGGAGGTCATCCCCATCGCCCCGCCCCTCCCCGACAGCGCCATTCCCCACTTCCCCGCTGGCAAGACTGCGGAGGATGTCGAGGCGGCT
GTAGGTCCCCGG
CTGTTTTATGGGTGGAGCGTTAGCTGACATATCTATATCTAGTGCGCCGAGACTCCCTTCCCGTCCTTCCCCACCGACCCCGGCCCGGCCACCTCTGTTGCCCCCGTGTAAGTCATCCTG
GCATTATCGCTTTGTGAGAGGTAACTGAACCACATTCATAGCCCCAATGAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGGCTCTCCTCTCCATCGTCTCCCTCGTCGCCGCACTTCAAGGCGTCGACGCTGCGCTCACCCGCCGCGTCGCTTGCCCGGACGGCATCAACACCGCGACCAACGCGGCG
TGCTGCGCCCTCTTCCCGATCCGGGACGACATCATCGAGAACCTCTTCCACAACCAGTGCGCCGAGGAGGCCCACGAGTCCCTCCGCCTGACCTTCCACGACGCCGTCGCCTTCTCGCCC
GCTGCGCAGGCTCGGGGCGAGTTCGGCGGTGGCGGCGCCGACGGGTCTATCGTCCTCTTCTCCGACATAGAGACGAACTTCCACGCGAACGACGGCACCGACGAGATCGTGGCGTTGCAG
AAGCCATTCATCGCGAAGAACAACATCTCCGCCGCTGACTT
CGTCCAGTTTGCGGGAGCCGTCGGGCTTGCTCAGTGCCCTGGTGCACCCCAGCTTGAGTTCTTGCTCGGCCGCCCGGAT
GCTACGCAGGCTGCCCCCGACGGTCTCGTCCCTGAGCCCTTCG
ACAGCGTCGACTCCATCCTATCCCGCCTGCTCGACGTCGGCTTCCAGGACTTCGAAGTCGTCTGGCTGCTCTCCGCC
CACACCGTCGCGGCCGCCGACCGTGTGGACACGACGATCCCGCGCACGCCCTTCGACTCGACCCCGGAGATCTTCGACACCCAGTTCTTCATCGAGACGCAGCTCGTCGGGCAGACCTTC
CCCGGCGTGGGCGGCGCGCAGGGCGAGGTCGTCTCCCCGATCCCGGGCGAGATGCGCCTGCAGTCCGACTTCCTCATCGCGCGCGACAGCCGCACCGCGTGCGAGTGGCAGTCGTTCACG
AACGACCAGGAGAAGTTCGCCGAGACGTTCCCGGACGTCATGGGCCGCCTGGCGCTCCTCGGCGTCGACCAGAGCACGCTCATCGACTGCTCGGAGGTCATCCCCATCGCCCCGCCCCTC
CCCGACAGCGCCATTCCCCACTTCCCCGCTGGCAAGACTGCGGAGGATGTCGAGGCGGCT
TGCGCCGAGACTCCCTTCCCGTCCTTCCCCACCGACCCCGGCCCGGCCACCTCTGTTGCC
CCCGT
CCCCAATGAGTGA

Retrieve as FASTA