Entry information : ParcLiP02
Entry ID 12291
Creation 2013-05-30 (Nizar Fawal)
Last sequence changes 2018-01-18 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-01-18 (Catherine Mathe)
Peroxidase information: ParcLiP02
Name ParcLiP02
Class Lignin peroxidase    [Orthogroup: LiP004]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Polyporaceae Polyporus
Organism Polyporus arcularius    [TaxId: 5639 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ParcLiP02
start..stop
S start..stop
ParcLiP05 713 0 1..365 1..365
ParcLiP04 694 0 1..365 1..365
ParcLiP01 682 0 1..364 1..364
ParcLiP03 635 0 1..364 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 32885..32945 61 N° 2 33009..33348 340 N° 3 33398..33519 122 N° 4 33574..34070 497
N° 5 34130..34194 65 N° 6 34250..34262 13  
join(32885..32945,33009..33348,33398..33519,33574..34070,34130..34194,34250..342 62)


exon

Literature and cross-references ParcLiP02
DNA ref. JGI genome:   scaffold_193 (32885..34262)
Cluster/Prediction ref. JGI gene:   599510
Protein sequence: ParcLiP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   365 (344)
PWM (Da):   %s   38916.52 (36761.3)  
PI (pH):   %s   4.45 (4.40) Peptide Signal:   %s   cut: 22 range:22-365
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKALLSLVSIVAAIQGASAALTRRVACPDGKNTATNAACCALFPIRDDIVQNLFHNQCAEEAHESLRLTFHDAVAFSPAAQARGEFAGGGADGSIVLFSEIETAFHANGGTDEIVALQKPFIAKHNISAADFIQFAGAVGLAQCPGAPQLEFRLGRKDATQAAPDGLVPEPFDTIDKILARLLDVGFQDFEVVWLLSAHTVAAADLVDPTIPRTPFDSTPEIFDTQFFIETQLRGQTFPGQGGVHGEVTSPLRGEMRLQSDHLLARDSRTACEWQSFTNDQEKFAETFPDVMGRLALLGVDESTLIDCSEVIPIAPPLPASSRPHFPAGKTHADIEQACAETPFPTFPTDPGPATVVAPVPNL*

Retrieve as FASTA  
Remarks complete sequence from genomics (5 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGGCTCTGCTCTCCCTCGTCTCCATCGTCGCTGCCATCCAGGGTGCCAGCGGTACGTTCATCGTTTCTCTCGTTCGCTGCTCTTATACTGACGCGCCCGTTATTATCTAC
ATAGCTGCCCTCACCCGGCGAGTCGCTTGCCCCGACGGCAAGAACACGGCGACCAACGCGGCGTGCTGCGCCCTCTTCCCGATCCGGGACGATATCGTACAGAACCTCTTCCACAACCAG
TGCGCAGAGGAGGCCCACGAGTCCCTCCGTCTGACCTTCCACGACGCCGTCGCGTTCTCGCCCGCTGCCCAAGCCCGTGGCGAGTTCGCCGGCGGAGGCGCCGACGGCTCCATCGTGCTC
TTCTCTGAGATCGAGACGGCGTTCCACGCCAACGGAGGCACGGACGAGATCGTCGCGCTGCAGAAGCCCTTCATCGCTAAGCACAACATCTCGGCCGCTGACTT
GTATGTTGTCCTTCCC
ATGTTTCCGTGCAGTTGCTTATGTGCTTGTCAGCATCCAATTCGCGGGTGCCGTCGGGCTCGCTCAGTGCCCGGGTGCACCTCAGCTCGAGTTCCGGCTCGGCCGCAAGGATGCTACCCA
AGCTGCTCCCGACGGTCTCGTGCCGGAGCCCTTCG
GTACGTACTCCCATCTTCCGCGTCATTCGATGTGTCTCTCATGATAGCCTCTAGACACCATCGACAAGATTCTCGCCCGCCTGCT
CGACGTCGGCTTCCAGGACTTCGAGGTCGTCTGGCTGCTCTCCGCACACACCGTCGCCGCCGCCGACCTGGTCGACCCGACGATCCCGCGCACGCCCTTCGACTCGACCCCCGAGATCTT
CGACACCCAGTTCTTCATCGAGACCCAGCTCCGCGGCCAGACCTTCCCCGGCCAAGGCGGCGTCCACGGCGAGGTGACGTCCCCGCTCCGCGGCGAGATGCGTCTCCAGTCCGACCACCT
CCTCGCGCGTGATTCGCGCACGGCATGCGAGTGGCAGTCGTTCACAAATGACCAGGAGAAATTCGCTGAGACGTTCCCGGACGTTATGGGCCGCCTTGCACTCCTCGGCGTTGATGAGAG
CACGCTCATCGACTGCTCGGAGGTCATCCCCATTGCCCCGCCCCTGCCCGCCAGCTCTCGCCCGCACTTCCCCGCTGGCAAGACCCACGCCGACATCGAGCAGGCG
GTGAGTACTTTACA
GCATGTGCTTCTACGCTCAGTTGCTGATTCACCTCAACCTCACAGTGCGCTGAGACGCCCTTCCCCACCTTCCCCACTGACCCCGGTCCGGCGACCGTCGTCGCTCCTGTGTAAGTTACA
CTCCCCACATCAAGGCTGCAATCATTTGCTGACATAGAACTCCAGTCCGAACCTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGGCTCTGCTCTCCCTCGTCTCCATCGTCGCTGCCATCCAGGGTGCCAGCGCTGCCCTCACCCGGCGAGTCGCTTGCCCCGACGGCAAGAACACGGCGACCAACGCGGCG
TGCTGCGCCCTCTTCCCGATCCGGGACGATATCGTACAGAACCTCTTCCACAACCAGTGCGCAGAGGAGGCCCACGAGTCCCTCCGTCTGACCTTCCACGACGCCGTCGCGTTCTCGCCC
GCTGCCCAAGCCCGTGGCGAGTTCGCCGGCGGAGGCGCCGACGGCTCCATCGTGCTCTTCTCTGAGATCGAGACGGCGTTCCACGCCAACGGAGGCACGGACGAGATCGTCGCGCTGCAG
AAGCCCTTCATCGCTAAGCACAACATCTCGGCCGCTGACTT
CATCCAATTCGCGGGTGCCGTCGGGCTCGCTCAGTGCCCGGGTGCACCTCAGCTCGAGTTCCGGCTCGGCCGCAAGGAT
GCTACCCAAGCTGCTCCCGACGGTCTCGTGCCGGAGCCCTTCG
ACACCATCGACAAGATTCTCGCCCGCCTGCTCGACGTCGGCTTCCAGGACTTCGAGGTCGTCTGGCTGCTCTCCGCA
CACACCGTCGCCGCCGCCGACCTGGTCGACCCGACGATCCCGCGCACGCCCTTCGACTCGACCCCCGAGATCTTCGACACCCAGTTCTTCATCGAGACCCAGCTCCGCGGCCAGACCTTC
CCCGGCCAAGGCGGCGTCCACGGCGAGGTGACGTCCCCGCTCCGCGGCGAGATGCGTCTCCAGTCCGACCACCTCCTCGCGCGTGATTCGCGCACGGCATGCGAGTGGCAGTCGTTCACA
AATGACCAGGAGAAATTCGCTGAGACGTTCCCGGACGTTATGGGCCGCCTTGCACTCCTCGGCGTTGATGAGAGCACGCTCATCGACTGCTCGGAGGTCATCCCCATTGCCCCGCCCCTG
CCCGCCAGCTCTCGCCCGCACTTCCCCGCTGGCAAGACCCACGCCGACATCGAGCAGGCG
TGCGCTGAGACGCCCTTCCCCACCTTCCCCACTGACCCCGGTCCGGCGACCGTCGTCGCT
CCTGT
TCCGAACCTCTAA

Retrieve as FASTA